Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-15b precursor URS000075B231_10090

Automated summary: This pre miRNA sequence is 64 nucleotides long and is found in Mus musculus. Annotated by 6 databases (RefSeq, MGI, Ensembl, miRBase, Ensembl/GENCODE, ENA). Described in 34 papers. Mus musculus (house mouse) microRNA mmu-mir-15b precursor sequence is a product of mir-15b precurso, Mir15b, mir-15b precursor, mir-15b, mmu-mir-15b precursor genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUGUAGCAGCACAUCAUGGUUUACAUACUACAGUCAAGAUGCGAAUCAUUAUUUGCUGCUCUAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species

    1. Equus caballus (horse) microRNA eca-mir-15b precursor
    2. Jaculus jaculus microRNA 15b (Mir15b)
    3. Loxodonta africana microRNA 15b
    4. Mus caroli microRNA 15b
    5. Mus pahari microRNA 15b
    6. Mus spretus microRNA 15b