Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-718 URS000075B1FD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-718: Hsa-mir-718 is a stably expressed normalizer that was identified using NormFinder on RNA-seq data [PMC7329382]. In addition to hsa-mir-718, hsa-piR-31068, a highly expressed piRNA, was also identified as a stably expressed normalizer [PMC7329382]. TaqMan probes were used for various genes, including hsa-mir-718 [PMC5591958]. The study also identified 16 markers, including hsa-mir-718, using specific probes [PMC4076980]. In patients with AS (ankylosing spondylitis), six miRNAs were found to be overexpressed (hsa-miR-193a-3p, hsa-miR-29b-1-5p, hsa-miR-505-5p, hsa-miR-194-5p, hsa-miR99b3p and hasmiR200b3p), while 14 miRNAs were downregulated (hsa-miR36633p, hasmiR513a5p hasmiR146b5p hasmiRNA1972 hasmir718 hasmiRNA3138 hasmir215p hasmir630 hasmir575 hasmir301a3p and so on) [PMC4989063]. However, it was found that hsa-mir718 was not amplified by real-time qPCR due to its low abundance in the plasma samples analyzed in the study [PMC6114494]. References: [PMC7329382] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7329382/ [PMC5591958] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5591958/ [PMC4076980] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4076980/ [PMC4989063] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4989063/ [PMC6114494] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6114494/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCCGCCCCGCCGGGCGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-718
Publications