Automated summary: This pre miRNA sequence is 76 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, RefSeq, miRBase, Ensembl). Matches 1 Rfam family (let-7, RF00027). Gallus gallus let-7a-3 stem-loop (gga-let-7a-3) sequence is a product of gga-let-7a-3 precursor, 7a-3, MIRLET7A3, let-7a-3, ENSGALG00010026067.1, let-7a-3 precurso, let-7a-3 precursor genes. Found in the Gallus gallus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGGUGAGGUAGUAGGUUGUAUAGUUUUAGGGUUAUGCCCUGCCUGUCAGAUAACUAUACAAUCUACUGUCUUUCCU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.