Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pundamilia nyererei pny-miR-22a URS000075B0BF_303518

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUGCCAGCUGAAGAACUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Cyprinus carpio (common carp) ccr-miR-22a
  2. Danio rerio dre-miR-22a-3p
  3. Gadus morhua Gmo-Mir-22-P1b1_3p (mature (guide))
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-22a
  5. Ictalurus punctatus ipu-miR-22a
  6. Maylandia zebra mze-miR-22a
  7. Monopterus albus (swamp eel) Mal-Mir-22-P1b1_3p (mature (guide))
  8. Mus musculus Mus_musculus piRNA piR-mmu-49806751
  9. Neolamprologus brichardi nbr-miR-22a
  10. Oreochromis niloticus oni-miR-22a
  11. Paralichthys olivaceus (Japanese flounder) pol-miR-22-3p
  12. Salmo salar ssa-miR-22a-3p
  13. Takifugu rubripes fru-miR-22a
  14. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-22a
  15. Tor tambroides miR-22a-3p
  16. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3648965