Sciurus vulgaris (Eurasian red squirrel) microRNA 200c (ENSSVLG00005000312.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sciurus vulgaris (Eurasian red squirrel) microRNA 200c (ENSSVLG00005000312.1) URS000075B099_55149

69 nucleotides
1 database (Ensembl)
Found in 7 other species
341 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCCUCGUCUUACCCAGCAGUGUUUGGGUGCUGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Cricetulus griseus (Chinese hamster) microRNA mir-200c (ENSCGRG00000021646.1, ENSCGRG00001008352.1)
Microtus ochrogaster (vole) microRNA 200c (ENSMOCG00000007531.1)
Mus caroli microRNA 200c (MGP_CAROLIEiJ_G0008051.1)
Mus musculus microRNA mmu-mir-200c precursor
Mus spretus (algerian mouse) microRNA 200c (MGP_SPRETEiJ_G0008467.1)
Ovis aries oar-mir-200c (ENSOARG00000021964.1)
Rattus norvegicus microRNA rno-mir-200c precursor

2D structure

Publications