Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rattus norvegicus (Norway rat) microRNA rno-mir-200c precursor secondary structure diagram

Rattus norvegicus (Norway rat) microRNA rno-mir-200c precursor URS000075B099_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-200c: Rno-mir-200c is expressed modestly in ZO cardiac tissue [PMC3184440]. It is located on chromosome 4 and has QTLs associated with heart rate [PMC3184440]. Rno-mir-200c has four-base and one-base mismatches compared to rno-miR-200b [PMC3895276]. Bioinformatics algorithms predict that rno-mir-200c targets the mitochondrial enzyme "holocytochrome-c synthetase" (HCCS) [PMC3794730]. Rno-miR-200b, rno-mir-200c, and rno-miR-214 are homologs of human hsa-miR-200b, hsa-miR-200c, and hsa-miR-214, respectively [PMC4693154]. Rno-miR-195 and rno-mir-200c are specifically expressed in the rat lung [PMC1790902].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUCGUCUUACCCAGCAGUGUUUGGGUGCUGGUUGGGAGUCUCUAAUACUGCCGGGUAAUGAUGGAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications