v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pavo cristatus (Indian peafowl) microRNA 200a (ENSPSTG00000017973.1) secondary structure diagram

Pavo cristatus (Indian peafowl) microRNA 200a (ENSPSTG00000017973.1) URS000075B06D_9049

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGUCCUCUGUGGGCAUCUUACUAGACAGUGCUGGAUUUCUUGGAUCUAUUCUAACACUGUCUGGUAACGAUGUUUAAAGGGUGAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Gallus gallus microRNA gga-mir-200a precursor
  2. Meleagris gallopavo (turkey) miRNA (ENSMGAG00000000499.2)
  3. Numida meleagris microRNA 200a (ENSNMEG00000009908.1)
  4. Phasianus colchicus microRNA 200a (ENSPCLG00000021768.1)
 2D structure