Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) B4GALT1 antisense RNA 1 (B4GALT1-AS1) URS000075AF86_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

B4GALT1-AS1: B4GALT1-AS1 is a long non-coding RNA (lncRNA) that has been studied in various cancer types. In non-small cell lung cancer (NSCLC), B4GALT1-AS1 mRNA expression was found to be significantly higher in NSCLC cell lines compared to normal lung cells [PMC7520745]. In osteosarcoma, B4GALT1-AS1 was found to enhance YAP mRNA stability, promoting cell stemness and migration [PMC7719841]. A binding site between B4GALT1-AS1 and miR-30e was identified [PMC7520745]. Silencing of B4GALT1-AS1 led to a decline in proliferation of A549 and H1299 cells, which was reversed by co-transfection with pc-SOX9 [PMC7520745]. These findings suggest that B4GALT1-AS1 plays a role in promoting cancer progression and may be a potential therapeutic target. Further research is needed to fully understand the mechanisms by which B4GALT1-AS1 functions in different cancer types.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCGAAACCCCCUCCCUAACUCAGCCCGGCUGGACCCCGCUGCUUAACGGGGGGUCCUGCGGCAAAGAAAGUGGACGGGUUGCCACUUCUGUGCCUCCCCAUCAGGUAGCCUGGGCUAUAAGGGGCUCUCAGACCAGCUUGGUUCCAGAUGUGUGUGUGGCGGGAGUCCUGUAUACUUUGAAGAGGAGAGCAGCAAGAAGCCUCUAACUCCCAGGCCAGCGUGCAGGAGAUCAGCCGGCGUUACAGUCUACACUGGGCUACCCACUGUCCCAUGAAGUAGCAGUUCUCCCCAUGUCGUAGAGUGGGGCCCCGGCAGAUUAAGAAACUUUCCUAAGAGCCCACAGCUGGCAAGAGGCAGAAUUCUGGCUCCGAAACCCAUGUUUUCUACAGGUUUACCCUUUGUUGAUUUGCAAGGGUUGGGAAACUAGUUUCCAUGGCCAAACCUAGCCCACCGUCUGUUUUGGUGUCCAUGGAUUGGCGGGGACAGCUCUGCUUAAGGAUGUAGUAGCUCUGCAGGUUGGCUAGUUUCCUGUUCUUCCCAACCUGCGCUAUGGACUUCAUCAGAUUUCAGCAUCAGAGAGAAUAUGGAAGGACAUCGACCCUAACUUCAUCCAGUGAGGAUUUCCACACACCAUACACUCUCUGAGAGUUCUCUUGGCUUUGUGUGCACACCUCCAGUGACAGGGAGCUCGCUAUGUCAUGAGGCAGCCUGCUCCCUUGUGGCUAUCACUGAACCAACUAUUAAGCCUUCUUAUACAAACAGUCCCUGACUUACUGUUAGACUUACAACUUUUUGAUUUUACAGUGGUGCAAAAGCAAUAUGCAUUCCAUAGAAACUGUAUUUCAAAUUUUGAAUUUUGAUCUUUUCCAGGCUAGCAACAUAUGAAGACCAACCUUCUAUUUUUAAAAUAGGCUUUGUGUUAGAUGCUUUUGCCCAACUAUAGGUUAAUGUAAAUGUUCUGAGAAUAUUUGAGGAAGGCUAGGCUAAACUGUGAUCUUUGGGAGCUUAGAUAUGUUAAGUGCAUUUUCAACUUACAAUAUUUUCAACUUACGAUGAGUUUAUUGGGAUGAAGCCCGUUGUAAGUAAAGGAGCAUCUGCAUUAAGCUAAAAUCCAUGUCUAUAACUUCCUCAGUAAUAUCAAGUUUGUUCCUUGGAGCCAGAGAAUAAACUGAAUCCUUUUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications