Otolemur garnettii (small-eared galago) microRNA 1277 (ENSOGAG00000021382.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Otolemur garnettii (small-eared galago) microRNA 1277 (ENSOGAG00000021382.1) URS000075AF7D_30611

78 nucleotides
2 databases (Ensembl, Rfam)
Found in 12 other species
29 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACCUCCCAAAUAUAUAUAUAUAUGUACGUAUGUGUAUAUAAAUGUAUACGUAGAUAUAUAUGUAUUUUUGGUGGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Callithrix jacchus mir-1277 microRNA precursor family
Chlorocebus sabaeus mir-1277 microRNA precursor family
Gorilla gorilla gorilla (western lowland gorilla) mir-1277 microRNA precursor family
Gorilla gorilla mir-1277 microRNA precursor family
Homo sapiens microRNA hsa-mir-1277 precursor
Macaca mulatta (Rhesus monkey) mir-1277 microRNA precursor family
Nomascus leucogenys (Northern white-cheeked gibbon) mir-1277 microRNA precursor family
Pan troglodytes mir-1277 microRNA precursor family
Papio anubis (Olive baboon) mir-1277 microRNA precursor family
Pongo abelii mir-1277 microRNA precursor family
Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-1277 precursor
Ictidomys tridecemlineatus mir-1277 microRNA precursor family

Publications