Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-568 precursor URS000075AF78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR568: MIR568 is a microRNA that has been found to be correlated with the expression of COPZ1 in various types of cancer, including HNSC, LIHC, BLCA, BRCA, and LUAD [PMC10137353]. In HNSC and LIHC, only MIR568 and MIR621 showed a correlation with COPZ1 expression [PMC10137353]. In BLCA, COPZ1 expression had a strong inverse relationship with MIR 23A, MIR24-2, MIR27A and MIR568 [PMC10137353]. Similarly, in BRCA, the expression of COPZ1 was significantly negatively associated with MIR 186, MIR221, MIR23B, MIR27A, MIR27B,M IR568 and MIR590 [PMC10137353]. In LUAD,M IR221,M IR23A,M IR30C2,M IR3677,M IR568 andM IRLET7D were negatively correlated with COPZ1 expression [PMC10137353]. Additionally,M I R374a ,M I R451a ,andM I R568 were found to regulate Nampt levels in cancer cells [PMC6315198]. Furthermore,S MAD2 is considered a target forM I R568[ PMC6258591]. Moreover ,MBNL2 is targeted by miRNA 548ab andM I R5688 ,while ZIC5 is targeted byM I R568[ PMC6258591]. Finally,in the hippocampus of adult rats only 10 out of 438 currently annotated miRNAs are expressed includingM ir155hg ,Mir3084d ,Mir770 ,Mir3577 ,Mir1949 ,Mir3597-2 ,MI R5 68,M ir1843b ,Mir3064,and Mir664-2[ PMC5776139 ]. Additionally,the non-coding RNA class includes small nucleolar RNA C/D box 3C (SNORD3C) and the miRNA precursor MIR568, which are both associated with ADAR1-p110 [PMC5333057].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUAUACACUAUAUUAUGUAUAAAUGUAUACACACUUCCUAUAUGUAUCCACAUAUAUAUAGUGUAUAUAUUAUACAUGUAUAGGUGUGUAUAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Pan troglodytes miRNA
  2. Pongo abelii miRNA
  3. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-568 precursor
Publications