Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1178 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1178 precursor URS000075AF6E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1178: MIR1178 is a microRNA encoding gene that is hypermethylated in the promoter region [PMC6085681]. It is a suppressor of CHIP, also known as STUB1, and the loss of CHIP has been associated with diabetes [PMC6533306]. In a study comparing methylation levels between cases and controls, the highest difference was observed in the TSS1500 region of MIR3621 (increase of 16.82%) and the TSS200 region of MIR1178 (decrease of 17.38%) [PMC9847511]. Differential methylation was also observed in other miRNA encoding genes such as MIR34C, MIR423, MIRLET7A2, MIR885, MIR548I3, MIR6854, MIR675, MIRLET7C, and MIR99A [PMC9847511]. This differential methylation may influence the expression of these genes [PMC9847511]. Additionally, transcripts of CIT are overlapped by both MIR939 and MIR1234; transcripts of CPSF1 are overlapped by both MIR939 andM IR1234; transcripts of PDCD4 are overlapped by bothM IR939 andM IR1234; transcripts of TAF4 are overlapped by bothM IR4680 andM IR1257 [PMC3886975].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGUUGGCUGGCAGAGGAAGGGAAGGGUCCAGGGUCAGCUGAGCAUGCCCUCAGGUUGCUCACUGUUCUUCCCUAGAAUGUCAGGUGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications