Automated summary: This pre miRNA sequence is 98 nucleotides long and is found in Aquila chrysaetos chrysaetos. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-203, RF00696). Aquila chrysaetos chrysaetos (golden eagle) microRNA 203b (ENSACCG00020014801.1) sequence is a product of ENSACCG00020014801.1 gene. Found in the Aquila chrysaetos chrysaetos reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CUCAGCCUCCUUGGUGCAGUGGUUCUUAACAGUUCAACAGUUCUCUAUCAUAAUUGUGAAAUGUUUAGGACCACUUGACCAGCGAGGCCCGGGCAUCG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.