Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-377 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-377 precursor URS000075AF10_9606

  • 69 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 25 species

Automated summary: This pre miRNA sequence is 69 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (RefSeq, Ensembl, GeneCards, miRBase, Ensembl/GENCODE, ENA, MalaCards, HGNC). Described in 42 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-377 precursor sequence is a product of mir-377 precursor, mir-377 precurso, MIR377, mir-377, hsa-mir-377 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAACUUUUGUUUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Aotus nancymaae miRNA
    3. Bos taurus (cattle) microRNA bta-mir-377 precursor
    4. Canis lupus familiaris microRNA cfa-mir-377 precursor
    5. Capra hircus (Goat) microRNA mir-377 (MIR377)
    6. Carlito syrichta (Philippine tarsier) miRNA
    7. Cercocebus atys (Sooty mangabey) miRNA
    8. Colobus angolensis palliatus microRNA 377
    9. Equus caballus (horse) microRNA eca-mir-377 precursor
    10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 377
    11. Macaca fascicularis (Crab-eating macaque) miRNA
    12. Macaca mulatta microRNA mml-mir-377 precursor
    13. Macaca nemestrina miRNA
    14. Mandrillus leucophaeus (Drill) miRNA
    15. Microcebus murinus miRNA
    16. Ochotona princeps miRNA
    17. Pan paniscus (bonobo) miRNA
    18. Panthera pardus miRNA
    19. Panthera tigris altaica (Tiger) miRNA
    20. Pan troglodytes (chimpanzee) ptr-mir-377
    21. Papio anubis (Olive baboon) miRNA
    22. Pongo abelii microRNA 377
    23. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-377 precursor
    24. Propithecus coquereli (Coquerel's sifaka) miRNA
    25. Rhinopithecus bieti miRNA
    26. Rhinopithecus roxellana miRNA
    27. Saimiri boliviensis boliviensis miRNA
    2D structure New