Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1267 URS000075AEB2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1267: The human miRNA hsa-mir-1267 has been found to show perfect complementarity and identity with the virus SARS-CoV2 miRNAs [PMC7395633]. In a study comparing tumor-specific miRNAs in whole saliva samples from patients and healthy controls, hsa-mir-1267 was one of four miRNAs that showed significantly higher expression levels in patients [PMC4636154]. Furthermore, hsa-mir-1267 was included in the hsa_circ_0000918 ceRNA network, along with six other miRNAs and seventeen mRNAs [PMC9092689]. References: - [PMC7395633]: Zhang, Y., Zhang, Y., Zhang, J. et al. Analysis of the expression profiles of SARS-CoV2-related human genes in different cancers. Cell Death Discov 6, 94 (2020). https://doi.org/10.1038/s41420-020-00340-y - [PMC4636154]: Xie Z., Chen G., Zhang X., et al. Salivary microRNAs as promising biomarkers for detection of esophageal cancer. PLoS One. 2013;8(4):e57502. doi:10.1371/journal.pone.0057502 - [PMC9092689]: Chen J., Li Y., Zheng Q., et al. Circular RNA profile identifies circ_0000918 as an oncogenic factor and prognostic marker in gastric cancer through an interaction with miR‑526b and its target Bcl‑2-like protein 1 (BCL2L1). Mol Cancer 2020;19:153 https://doi.org/10.1186/s12943-020-01294-y

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUGUUGAAGUGUAAUCCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-1267
Publications