Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-190b precursor URS000075AE48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-190b: Hsa-mir-190b, an miRNA, was found to be upregulated and involved in the regulation of FGF2 downregulation, which in turn alleviated the inflammatory response and vascular endothelial injury [PMC8923688]. Additionally, hsa-mir-190b was found to activate the expression of FGF2 and FGFR1 proteins [PMC8923688]. On the other hand, hsa-mir-190b and hsa-miR-449a were identified as the most significantly downregulated miRNAs [PMC7499949]. The upregulation of hsa-mir-190b suggests its potential role in modulating FGF2 expression [PMC8923688]. This regulation of FGF2 may contribute to the alleviation of inflammatory response and vascular endothelial injury [PMC8923688]. The activation of FGF2 and FGFR1 protein expression by hsa-mir-190b further supports its involvement in cellular processes [PMC8923688]. In contrast to its upregulation, hsa-mir-190b was found to be downregulated along with hsa-miR-449a [PMC7499949]. This downregulation suggests a potential role for these miRNAs in different cellular processes or pathways [PMC7499949]. In summary, hsa-mir-190b is an miRNA that is upregulated and involved in regulating FGF2 expression [PMC8923688]. This regulation may contribute to alleviating inflammatory response and vascular endothelial injury while activating FGF2 and FGFR1 protein expression [PMC8923688]. Additionally, both hsa-mir-190b and hsa-miR-449a were significantly downregulated [PMC7499949] [PMC8923688].

MIR190B: MIR190B is a microRNA that has been identified as one of the deregulated miRNAs in various studies [PMC6615718] [PMC6468970] [PMC7918779]. It has been found to be involved in multiple pathways, including the regulation of ATG7 mRNA [PMC6468970]. In one study, MIR190B was found to be one of the miRNAs that discriminate between different grades of cancer [PMC7918779]. Another study found that MIR190B demonstrated low expression levels in a specific cell line [PMC3929981]. Additionally, high expression of MIR190B has been associated with a poor response to radiotherapy in patients with rectal cancer [PMC9065280]. The MIR190B gene is located on rat chromosome 2 and is predicted to reside within a specific interval on this chromosome [PMC3339715] [PMC4263296]. It has also been found to be deleted in certain genetic abnormalities, along with other genes such as C1orf189 and TPM3 [PMC5240603]. In terms of its function, MIR190B has been identified as a neuroprotective molecule that can be transported by astrocyte-derived exosomes to protect neurons against toxic insults [PMC8393731]. Overall, these studies highlight the importance and diverse roles of MIR190B in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCUUCUGUGUGAUAUGUUUGAUAUUGGGUUGUUUAAUUAGGAACCAACUAAAUGUCAAACAUAUUCUUACAGCAGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications