Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-559 URS000075AE29_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-559: Hsa-mir-559 is a miRNA that has been identified as a key post-transcriptional regulatory factor for hHubGs-sets {CCNA2, CDK2, BRCA1}, {CHEK1, TYMS, BRCA1, TOP2A}, and {CDK2, MKI67, CCNB1} [PMC9395557]. It has been found to be one of the three significant miRNAs in the network analysis of hHubGs with miRNAs [PMC9395557]. In a luciferase reporter assay, hsa-mir-559 was shown to directly bind to the 3’UTR of EPHA3 and inhibit its function [PMC10014861]. Additionally, hsa-mir-559 was found to differentially target the FXN gene along with eight other miRNAs [PMC3559822]. In a study comparing different groups of patients with prostate cancer, hsa-mir-559 was found to be upregulated in the P alone group and overexpressed in the P + E support group [PMC3462109]. Hsa-mir-559 was also identified as one of the top-ranked miRNAs along with hsa-miR-4474-5p in another study [PMC5628841]. It has been observed that hsa-mir-559 and its opposite strand have consensus sequences in 5′ and 3′ arms respectively [PMC3102724]. However, concentrations of hsa-miR-569, hsa-miR-613, hsa-miR-653 and hsa-miR526b were too low to be analyzed [PMC3942699].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAAGUAAAUAUGCACCAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-559
  2. Pan troglodytes ptr-miR-559
Publications