Automated summary: This pre miRNA sequence is 82 nucleotides long and is found in Mus musculus. Annotated by 5 databases (ENA, RefSeq, MGI, Ensembl, miRBase). Described in 18 papers. Matches 1 Rfam family (mir-290, RF00665). Mus musculus (house mouse) microRNA mmu-mir-291a precursor sequence is a product of mir-291a, mir-291a precurso, mmu-mir-291a precursor, mir-291a precursor, ENSMUSG00000078008.3, Mir291a genes. Found in the house mouse reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCUAUGUAGCGGCCAUCAAAGUGGAGGCCCUCUCUUGAGCCUGAAUGAGAAAGUGCUUCCACUUUGUGUGCCACUGCAUGGG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.