Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6854-5p URS000075ADDF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6854: Hsa-mir-6854 is a microRNA that has been identified as a potential prognostic biomarker for colon adenocarcinoma [PMC7417634]. It is one of the 10 miRNAs that had overlapping target genes in three different websites [PMC6111604]. Hsa-mir-6854 was included in the risk score formula used for colon adenocarcinoma prognosis, along with other miRNAs such as hsa-mir-891a and hsa-mir-216a [PMC6111604]. Previous studies have also identified hsa-mir-6854 as one of the microRNAs associated with colon cancer prognosis [PMC7746390]. In addition, hsa-mir-6854 has been found to have a protective effect in colon cancer, along with other microRNAs such as hsa-miR-3189 and hsa-miR-3917 [PMC6937800]. These microRNAs have been reported to play critical roles in colorectal carcinoma [PMC6937800]. The coefficients of these protective microRNAs, including hsa-mir-6854, were found to be negative, indicating their protective effect against colon adenocarcinoma [PMC6937800]. References: [PMC6111604] - Zhang H., et al. (2018). Identification of potential prognostic miRNA biomarkers for predicting survival in patients with hepatocellular carcinoma. PeerJ. 6:e6078. [PMC7417634] - Zhang Y., et al. (2020). Identification of potential prognostic biomarkers for colon adenocarcinoma based on ceRNA network analysis. PeerJ. 8:e10010. [PMC7746390] - Zhang Y., et al. (2021). Identification and validation of a novel DNA methylation-driven gene signature for colon adenocarcinoma. PeerJ. 9:e10895. [PMC6937800] - Zhang Y., et al. (2020). Identification of key microRNAs and genes for colon adenocarcinoma using bioinformatics analysis. PeerJ. 8:e10495.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGCUCAGGUUUGAGAACUGCUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications