Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-2861 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-2861 precursor URS000075ADBF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR2861: MIR2861 is a non-coding mRNA that plays a role in bone formation and bone mass in mice [PMC7423897]. It is not detectable in adult brains [PMC5146867]. The level of MIR2861 does not significantly change across different paradigms [PMC5146867]. MIR2861, along with other non-coding mRNA and immunologic genes, is not captured by standard exome kits [PMC9338263]. MIR2861 may have a common binding sequence with the lncRNA SNHG14, which may be dysregulated in hMSCs differentiation [PMC7415173]. The role of lncRNA SNHG14 and its relationship with MIR2861 and osteoblastic differentiation of hMSCs is being investigated [PMC7415173]. MIR2861 also participates in the regulatory feedback loop during mouse osteoblast differentiation [PMC7415173]. In a cluster of differentially expressed miRNAs, MIR2861 is one of the miRNAs identified [PMC8235499]. In patients with Hodgkin lymphoma, MIR2861 is significantly elevated in plasma and positively correlated with Hasenclever scores [PMC4944540].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCCUCUGCAGCUCCGGCUCCCCCUGGCCUCUCGGGAACUACAAGUCCCAGGGGGCCUGGCGGUGGGCGGCGGGCGGAAGAGGCGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications