Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1258 precursor URS000075ADAC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1258: Hsa-mir-1258 is a cellular miRNA that inhibits the reactivation of Kaposi's sarcoma-associated herpesvirus (KSHV) from latency and downregulates the expression of heparanase (HPSE) protein levels, which restricts breast cancer brain metastasis invasion [PMC7252873]. It is negatively correlated with several transmembrane emp24 domain-containing proteins (TMEDs) and is considered a tumor suppressor in breast cancer [PMC9816852]. Hsa-mir-1258 is upregulated in the skin of patients with postherpetic neuralgia (PHN) [PMC8914318]. It has also been found to be downregulated in gastric cancer and breast cancer, where it targets HPSE and reactivation transcriptional activator (RTA), respectively [PMC4350105] [PMC7354774]. Hsa-mir-1258 has been identified as one of the top upregulated differentially expressed miRNAs in ischemic stroke samples [PMC3565366]. It is also altered in metastatic cancers, including gastric cancer and acute myocardial infarction, where it may serve as a diagnostic biomarker [PMC4491873] [PMC9061009] [PMC8923688]. Overall, hsa-mir-1258 plays a role in inhibiting viral reactivation, regulating tumor metastasis, and may have diagnostic potential for certain diseases.

MIR1258: MIR1258, a type of microRNA, was found to be highly expressed in preterm infants with bronchopulmonary dysplasia (BPD) for the first time, and it was identified as a risk factor for BPD [PMC9061009]. Additionally, MIR1258 has been shown to inhibit the proliferation of various tumor cells in vivo, including non-small-cell lung cancer, liver cancer, and breast cancer [PMC9061009]. Methylation levels of MIR1258 were significantly associated with the survival of patients with ovarian cancer (OvCa) according to Kaplan-Meier analysis [PMC8835734]. High methylation levels of MIR1258 were predominantly observed in metastatic primary tumors and not at the early stages of OvCa pathogenesis [PMC8835734]. Furthermore, hypermethylated MIR1258 has been found to be specifically involved in various steps of OvCa spread, supporting its role in the progression, epithelial-mesenchymal transition (EMT), and metastasis of OvCa and other cancers [PMC8835734]. There is an overlap between miRNA genes associated with metastasis and those associated with advanced stages of OvCa progression. Four miRNA genes including MIR1258 showed a less statistically significant association with early stages compared to their association with OvCa pathogenesis as a whole [PMC8835734].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGUGGCUUCCACGACCUAAUCCUAACUCCUGCGAGUCCCUGGAGUUAGGAUUAGGUCGUGGAAGCCACAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications