Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) microRNA gga-mir-29b precursor (gga-mir-29b-1) URS000075AD70_9031

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (ENA, Ensembl, miRBase, RefSeq). Matches 1 Rfam family (mir-29, RF00074). Gallus gallus (chicken) microRNA gga-mir-29b precursor (gga-mir-29b-1) sequence is a product of 1, MIR29B1, 29b-1, ENSGALG00010007829.1, mir-29b-1, gga-mir-29b-1 precursor, mir-29b-1 precursor, mir-29b-1 precurso genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAACUAUUCAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Accipiter nisus (Eurasian sparrowhawk) microRNA 29b-1 (ENSANIG00000009901.1)
    2. Amazona collaria (yellow-billed parrot) microRNA 29b-1 (ENSACOG00000008428.1)
    3. Apteryx rowi microRNA 29b-1 (ENSARWG00000001119.1)
    4. Aquila chrysaetos chrysaetos (golden eagle) microRNA 29b-1 (ENSACCG00020003315.1)
    5. Athene cunicularia microRNA 29b-1 (ENSACUG00000003489.1)
    6. Bubo bubo miRNA (ENSBOBG00000002644.1)
    7. Buteo japonicus miRNA (ENSBJAG00000012279.1)
    8. Calidris pugnax (ruff) microRNA 29b-1 (ENSCPUG00000000182.1)
    9. Calidris pygmaea (Spoon-billed sandpiper) microRNA 29b-1 (ENSCPGG00000016809.1)
    10. Camarhynchus parvulus miRNA (ENSCPVG00005009834.1)
    11. Catharus ustulatus miRNA (ENSCUSG00005016816.1)
    12. Corvus moneduloides miRNA (ENSCMUG00000006485.1)
    13. Cyanistes caeruleus (blue tit) microRNA 29b-1 (ENSCCEG00000002577.1)
    14. Cyanoderma ruficeps microRNA 29b-1 (ENSCRFG00000001870.1)
    15. Dromaius novaehollandiae (emu) microRNA 29b-1 (ENSDNVG00000010767.1)
    16. Chloebia gouldiae microRNA 29b-1 (ENSEGOG00005005646.1)
    17. Falco tinnunculus miRNA (ENSFTIG00000008866.1)
    18. Ficedula albicollis (Collared flycatcher) microRNA 29b-1 (ENSFALG00000026388.1)
    19. Geospiza fortis microRNA 29b-1 (ENSGFOG00000006703.1)
    20. Junco hyemalis microRNA 29b-1 (ENSJHYG00000017466.1)
    21. Lepidothrix coronata microRNA 29b-1 (ENSLCOG00000010284.1)
    22. Lonchura striata domestica (Bengalese finch) microRNA 29b-1 (ENSLSDG00000003489.1)
    23. Malurus cyaneus samueli miRNA (ENSMCSG00000004193.1)
    24. Manacus vitellinus (golden-collared manakin) microRNA 29b-1 (ENSMVIG00005019818.1)
    25. Melopsittacus undulatus miRNA (ENSMUNG00015015371.1)
    26. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000014583.1)
    27. Parus major (Great Tit) microRNA 29b-1 (ENSPMJG00000000536.1)
    28. Serinus canaria (common canary) microRNA 29b-1 (ENSSCAG00000012530.1)
    29. Strigops habroptila microRNA 29b-1 (ENSSHBG00005002217.1)
    30. Strix occidentalis caurina miRNA (ENSSOCG00000000257.1)
    31. Struthio camelus australis microRNA 29b-1 (ENSSCUG00000012131.1)
    32. Taeniopygia guttata (zebra finch) microRNA 29b-1 (ENSTGUG00000017869.2)
    33. Zonotrichia albicollis microRNA 29b-1 (ENSZALG00000001899.1)
    34. Zosterops lateralis melanops microRNA 29b-1 (ENSZLMG00000000676.1)
    Publications New