Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Dromaius novaehollandiae. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-29, RF00074). Dromaius novaehollandiae (emu) microRNA 29b-1 (ENSDNVG00000010767.1) sequence is a product of ENSDNVG00000010767.1 gene. Found in the Dromaius novaehollandiae reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAACUAUUCAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGG
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.