Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Accipiter nisus (Eurasian sparrowhawk) microRNA 29b-1 (ENSANIG00000009901.1) URS000075AD70_211598

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Accipiter nisus. Annotated by 1 database (Ensembl). Matches 1 Rfam family (mir-29, RF00074). Accipiter nisus (Eurasian sparrowhawk) microRNA 29b-1 (ENSANIG00000009901.1) sequence is a product of ENSANIG00000009901.1 gene. Found in the Accipiter nisus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CCUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAACUAUUCAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 33 other species

    1. Amazona collaria (yellow-billed parrot) microRNA 29b-1 (ENSACOG00000008428.1)
    2. Apteryx rowi (Okarito brown kiwi) microRNA 29b-1 (ENSARWG00000001119.1)
    3. Aquila chrysaetos chrysaetos microRNA 29b-1 (ENSACCG00020003315.1)
    4. Athene cunicularia microRNA 29b-1 (ENSACUG00000003489.1)
    5. Bubo bubo (Eurasian eagle-owl) miRNA (ENSBOBG00000002644.1)
    6. Buteo japonicus miRNA (ENSBJAG00000012279.1)
    7. Calidris pugnax (ruff) microRNA 29b-1 (ENSCPUG00000000182.1)
    8. Calidris pygmaea (Spoon-billed sandpiper) microRNA 29b-1 (ENSCPGG00000016809.1)
    9. Camarhynchus parvulus miRNA (ENSCPVG00000012994.2)
    10. Catharus ustulatus miRNA (ENSCUSG00005016816.1)
    11. Corvus moneduloides miRNA (ENSCMUG00000006485.1)
    12. Cyanistes caeruleus microRNA 29b-1 (ENSCCEG00000002577.1)
    13. Cyanoderma ruficeps microRNA 29b-1 (ENSCRFG00000001870.1)
    14. Dromaius novaehollandiae (emu) microRNA 29b-1 (ENSDNVG00000010767.1)
    15. Chloebia gouldiae (Gouldian finch) microRNA 29b-1 (ENSEGOG00005005646.1)
    16. Falco tinnunculus miRNA (ENSFTIG00000008866.1)
    17. Ficedula albicollis (Collared flycatcher) microRNA 29b-1 (ENSFALG00000026388.1)
    18. Gallus gallus (chicken) microRNA gga-mir-29b precursor (gga-mir-29b-1)
    19. Geospiza fortis microRNA 29b-1 (ENSGFOG00000006703.1)
    20. Junco hyemalis microRNA 29b-1 (ENSJHYG00000017466.1)
    21. Lepidothrix coronata microRNA 29b-1 (ENSLCOG00000010284.1)
    22. Lonchura striata domestica microRNA 29b-1 (ENSLSDG00000003489.1)
    23. Malurus cyaneus samueli (superb fairywren) miRNA (ENSMCSG00000004193.1)
    24. Manacus vitellinus microRNA 29b-1 (ENSMVIG00005019818.1)
    25. Melopsittacus undulatus (budgerigar) miRNA (ENSMUNG00000021044.1)
    26. Otus sunia (Oriental scops-owl) miRNA (ENSOSUG00000014583.1)
    27. Parus major (Great Tit) microRNA 29b-1 (ENSPMJG00000000536.1)
    28. Serinus canaria microRNA 29b-1 (ENSSCAG00000012530.1)
    29. Strigops habroptila (Kakapo) microRNA 29b-1 (ENSSHBG00005002217.1)
    30. Strix occidentalis caurina miRNA (ENSSOCG00000000257.1)
    31. Struthio camelus australis (African ostrich) microRNA 29b-1 (ENSSCUG00000012131.1)
    32. Taeniopygia guttata (zebra finch) microRNA 29b-1 (ENSTGUG00000017869.2)
    33. Zonotrichia albicollis microRNA 29b-1 (ENSZALG00000001899.1)
    34. Zosterops lateralis melanops (silver-eye) microRNA 29b-1 (ENSZLMG00000000676.1)