Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4484 precursor URS000075AD55_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4484: MIR4484 is an RNA gene located at chromosome 10 in locus q26.2. It has been shown to act as a tumor suppressor [PMC6776520]. Copy number analysis of the MIR4484 locus was performed using SYBR green-based quantitative PCR with DNA-specific primers [PMC5537698]. The genomic levels of the region encompassing the MIR4484 precursor sequence were assayed, and it was found that the MIR4484 locus undergoes copy number loss [PMC5537698]. The C t values of MIR4484 were normalized with the C t value of GAPDH to obtain ΔC t, and the final copy number was deduced using the ΔΔC t method [PMC5537698]. The deletion at the UROS locus, which is closely located to MIR4484, affected both UROS and MIR4484 genes but did not affect nearby genes such as BRCA2 and CDKN1A interacting protein (BCCIP) and matrix metallopeptidase 21 (MMP21) [PMC5537698]. The correlation between deletion patterns in UROS and MIR4484 was observed through DNA qPCR analysis in a similar set of samples [PMC5537698]. It is worth noting that metalloproteinases, such as matrix metalloproteinase 21 (MMP-21), which is closely located to MIR4484, are known to be involved in fibrotic processes in systemic sclerosis (SSc) [PMC6776520].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGUUUCCUCUGCCUUUUUUUCCAAUGAAAAUAACGAAACCUGUUAUUUCCCAUUGAGGGGGAAAAAGGCGGGAGAAGCCCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications