Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-203a precursor URS000075ACBD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR203A: MIR203A is a gene that is downregulated in certain cell lines, such as A2780, and its expression is not significantly increased in response to estrogen treatments [PMC7766742]. The hypermethylation of the MIR203A gene has been suggested as a marker for predicting the development of metastases in ovarian cancer [PMC8835734]. Previous studies have shown that MIR203A and the MIR200 family are downregulated in D492M cell lines and their expression is crucial for maintaining the epithelial phenotype [PMC7308478]. The MIR203A locus is located on chromosome 14, specifically at chr14:104097437–104137437 [PMC7766742]. In stage IV ovarian cancer patients, alterations in six miRNAs, including MIR203A, have been observed [PMC9599289]. Additionally, it has been demonstrated that MIR203A enhances cellular inflammatory responses and cell damage while reducing aggrecan and Col2A1 levels [PMC10002134]. The expression of miR200s and MIR203A was investigated to determine their dependence on ERα [PMC7766742]. References: - PMC7766742 - PMC8835734 - PMC7308478 - PMC9599289 - PMC10002134

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGUUGGGGACUCGCGCGCUGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUAGCGCAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGGGCGCGGCGACAGCGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications