Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-455 precursor URS000075AC6B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR455: MIR455 is a microRNA that is implicated in various diseases and conditions. It is specifically linked with hepatocellular carcinoma (HCC), gastric cancer (GC), and colorectal cancer (CRC) [PMC8369952]. In addition, MIR455 is associated with endometrial cancers [PMC8369952]. It has been found that certain microRNAs, including MIR455, regulate brown adipocyte differentiation [PMC7123371]. In multiple myeloma patients, high expression of MIR455 is considered a favorable prognostic factor [PMC6183594]. Furthermore, irregular expression of MIR455 has been observed in patients with preeclampsia, suggesting its potential role in the pathogenesis of the condition [PMC4540200]. Interestingly, MIR455 has also been detected in the exosomal population after exercise in type 2 diabetic mice, indicating that its content varies depending on the cells of origin at the time of secretion [PMC4568920]. MIR455 and Mir511 are largely expressed in the alimentary system and are involved in response to stimulus processes [PMC8369952]. In terms of cardiovascular health, MIR455 has been found to be cardioprotective in type 1 diabetes mellitus (T1DM) while Mir22 plays a similar role in type 2 diabetes mellitus (T2DM) [PMC7593653]. The formation of MIR455 is induced by cold temperature exposure and BMP7. This induction is necessary for the development of both brown adipose tissue (BAT) and recruitable beige adipose tissue (BeAT) [PMC7123371]. To verify predicted targets for MIR455 and to test its functionality within miRNA-induced silencing complex (miRISC), a dual luciferase-based miRNA-activity reporter assay was adopted. This assay involved renilla luciferase (RL) and firefly luciferase (FL) reporter genes [PMC4540200]. The observed elevation in mature MIR455 in BeWo cells upon FSK treatment can be attributed to increased expression of the COL27A1 gene [PMC4540200].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCUGGCGUGAGGGUAUGUGCCUUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGCCUAUGUCAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 40 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 455 (ENSANAG00000002175.1)
  2. Balaenoptera musculus microRNA 455 (ENSBMSG00010006277.1)
  3. Callithrix jacchus (white-tufted-ear marmoset) microRNA 455 (ENSCJAG00000024634.3)
  4. Capra hircus microRNA mir-455 (ENSCHIG00000009417.1)
  5. Carlito syrichta (Philippine tarsier) microRNA 455 (ENSTSYG00000036210.1)
  6. Catagonus wagneri (Chacoan peccary) microRNA 455 (ENSCWAG00000017227.1)
  7. Cebus imitator (Panamanian white-faced capuchin) microRNA 455 (ENSCCAG00000003806.1)
  8. Cercocebus atys microRNA 455 (ENSCATG00000009721.1)
  9. Cervus hanglu yarkandensis microRNA 455 (ENSCHYG00000019048.1)
  10. Chlorocebus sabaeus (African green monkey) microRNA 455 (ENSCSAG00000027567.1)
  11. Colobus angolensis palliatus miRNA (ENSCANG00000007279.1)
  12. Delphinapterus leucas microRNA 455 (ENSDLEG00000004162.1)
  13. Equus asinus asinus microRNA 455 (ENSEASG00005022655.1)
  14. Equus asinus (ass) microRNA 455 (ENSEASG00005022655.2)
  15. Equus caballus (horse) microRNA 455 (ENSECAG00000039316.1)
  16. Gorilla gorilla gorilla microRNA 455 (ENSGGOG00000031215.2)
  17. Macaca mulatta microRNA mml-mir-455 precursor
  18. Macaca nemestrina (Pig-tailed macaque) microRNA 455 (ENSMNEG00000010029.1)
  19. Mandrillus leucophaeus (Drill) microRNA 455 (ENSMLEG00000004151.1)
  20. Monodon monoceros (narwhal) microRNA 455 (ENSMMNG00015021213.1)
  21. Moschus moschiferus (Siberian musk deer) microRNA 455 (ENSMMSG00000013841.1)
  22. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 455 (ENSNLEG00000019773.2)
  23. Oryctolagus cuniculus (rabbit) microRNA 455 (ENSOCUG00000018513.1)
  24. Otolemur garnettii (small-eared galago) microRNA 455 (ENSOGAG00000017352.1)
  25. Ovis aries miRNA (ENSOARG00000021213.1)
  26. Pan paniscus (bonobo) microRNA 455 (ENSPPAG00000006088.1)
  27. Pan troglodytes ptr-mir-455 (ENSPTRG00000027749.2)
  28. Physeter catodon (sperm whale) microRNA 455 (ENSPCTG00005022401.1)
  29. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 455 (ENSPTEG00000035091.1)
  30. Pongo abelii microRNA 455 (ENSPPYG00000022117.2)
  31. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-455 precursor
  32. Procavia capensis (cape rock hyrax) microRNA 455 (ENSPCAG00000019980.1)
  33. Rhinopithecus bieti microRNA 455 (ENSRBIG00000007055.1)
  34. Rhinopithecus roxellana microRNA 455 (ENSRROG00000037431.1)
  35. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 455 (ENSSBOG00000017724.1)
  36. Sus scrofa (pig) microRNA 455 (multiple genes)
  37. Theropithecus gelada (gelada) microRNA 455 (ENSTGEG00000027968.1)
  38. Tursiops truncatus (bottlenosed dolphin) microRNA 455 (ENSTTRG00000022586.1)
  39. Vicugna pacos (alpaca) miRNA (ENSVPAG00000017224.1)
Publications