Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-4463 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-4463 precursor URS000075ABF8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4463: MIR4463 is a microRNA that has been studied in relation to its regulation of CYP19A1 and ESR1 expression in KGN cells [PMC7482943]. Recent research has shown that MIR4463 expression is significantly upregulated in the serum of patients with polycystic ovary syndrome (PCOS), although its specific biological functions related to PCOS are still unknown [PMC7482943]. However, the data strongly suggest that MIR4463 plays a crucial role in regulating 17β-estradiol synthesis by targeting CYP19A1 and ESR1 in KGN cells [PMC7482943]. To validate these findings, a comparison of MIR4463 expression levels in the serum of poor responders and normal responders undergoing in vitro fertilization (IVF) is needed [PMC7482943]. Interestingly, it was found that MIR4463 showed significantly increased expression in poor responders, indicating its potential role in regulating 17β-estradiol synthesis and suggesting it as a potential predictor of poor ovarian response (POR) [PMC7482943]. Immunoblotting analyses further supported these findings by demonstrating that the miR-4463 mimic decreased CYP19A1 protein expression levels by approximately 40%, while the MIR4463 inhibitor treatment did not affect CYP19A1 expression [PMC7482943]. Overall, these results suggest that upregulation of MIR4463 may contribute to reduced 17β-estradiol production and POR, highlighting its potential as a therapeutic target or predictor for POR patients undergoing IVF treatment [PMC7482943].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAGAUUAUUGGUCACCACCUCCAGUUUCUGAAUUUGUGAGACUGGGGUGGGGCCUGAGAAUUUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications