v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2298 (LINC02298) URS000075AB90_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02298: LINC02298 is a long non-coding RNA (lncRNA) that has been identified as one of the five FRLs (Functional RNA-like) used to construct a prognostic model for patient stratification based on genomic characteristics [PMC9273977]. It has been found to be negatively correlated with the expression level of PD-L1 [PMC9273977]. In a heatmap analysis, LINC02298 was found to be highly expressed in FRL-C1, which is associated with increased expression of other FRLs [PMC9273977]. The specific roles and mechanisms of LINC02298 in cancer have not been fully elucidated [PMC9273977]. Furthermore, the expression of LINC02298 has been found to correlate with patient age [PMC9273977]. In addition, LINC02298 has been implicated in the upstream regulation of GPRIN1 and associated with detrimental outcomes in kidney renal papillary cell carcinoma and LUAD (Lung Adenocarcinoma) [PMC9273977]. It is also suggested that LINC02298 may be part of the ceRNA regulatory mechanism network involving the miR140-3p/GPRIN1 axis in LUAD [PMC8487820]. In summary, LINC02298 is an lncRNA that plays a role in patient stratification based on genomic characteristics and is negatively correlated with PD-L1 expression. Its specific roles and mechanisms in cancer are not fully understood. It may be involved in regulating GPRIN1 and have implications for outcomes in kidney renal papillary cell carcinoma and LUAD. Additionally, it may be part of a ceRNA regulatory mechanism network involving the miR140-3p/GPRIN1 axis. Further research is needed to fully elucidate its functions and mechanisms.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCAGCUGUGCGCUGGGGACACACGAGAUGCUCACCCUCCCUGCCCUCCAGGAGCUUGGACUCAGCUGAGAUGCCUGGUAUCCAACUGCACUUCUCCAUGUGUGCAUUGUCCCCUGAGCUGGCAAGAAGAUCCUACUAGUUGGUCUGCAUGCCAUGCCAGCUCGGCCUUGCACCCUGGGGGCCCAGCUGUUGUCCACACCAAGGGUGGCCUACAGAGGGAAGUGAGGACCUUGGGACUUCCUCCAGGACAGCCCUCGCUGUCCAAAUCUCCACCUGCUGCAGAGCUGCCUCCAGUCAAGCCCUUGUUUCCAGCUUUCUGUGCCCUAAAUAAACUUCUGCUGGGAUUGAGCCAUCAGCAUUCUGUGGUGGGCGUCGCUGCUGCGAGGUUGCCCUCGUGCACACAAGCUCCUCACAGGACUUCCAGGAUGAUAUGGAAGAGUGACUGAGAGCAGCCGCCCGGUGCUUCCCAACCUUAGAGGGAGGUCACGGGCAGUCUCCCUGCGAUGCUGGCCACAGGGUCUCGCUGUGUCGCCCAGGCUGGAGGGCAGUGGUGUGAUCUGGACUCACUGCAGCCUCGACCUGUUGGGCUCAAGUGAUCCUCUCACGUCAGCCUCCAAGUAGCCAAGACCACAGGCAGGCGUCACCAUGCCCAGCCCCCAUGAUGACUUUACUUUUCUUCUUGAACCUGAUGGAGUCUCACUCUGUUGCCCAGGCUGAAGUGCAAUGGCGCGAUCAUGACUCACUGCAACCUCCGCCUCCUGGGUUCAAGCGACUCUCCUGCCUCAGCCUCCAGAGUUGCUGGGAUUACAGGCACCCACAACCAUACCCUAAAUUUUGUACUUUUAGUAAAGAUGGGGUUUCACCAUUUGGCCAGGCUUGUCUUGAACUCCCAAUUACCAAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications