Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-323a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-323a precursor URS000075AB81_9606

  • 86 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 90 species

Automated summary: This pre miRNA sequence is 86 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl, HGNC, miRBase, Ensembl/GENCODE, GeneCards, RefSeq, MalaCards, ENA). Described in 35 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-323a precursor sequence is a product of ENSG00000199069.3, mir-323a precurso, MIR323A, mir-323a, mir-323a precursor, hsa-mir-323a precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUGGUACUUGGAGAGAGGUGGUCCGUGGCGCGUUCGCUUUAUUUAUGGCGCACAUUACACGGUCGACCUCUUUGCAGUAUCUAAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 89 other species

    1. Ailuropoda melanoleuca microRNA 323a (ENSAMEG00000028249.1)
    2. Balaenoptera musculus (Blue whale) microRNA 323a (ENSBMSG00010004580.1)
    3. Bison bison bison miRNA (ENSBBBG00000023539.1)
    4. Bos grunniens (domestic yak) microRNA 323a (ENSBGRG00000011153.1)
    5. Bos indicus x Bos taurus (hybrid cattle) microRNA 323a (ENSBIXG00000013939.1, ENSBIXG00005002317.1)
    6. Bos mutus (wild yak) miRNA (ENSBMUG00000005212.1)
    7. Bos taurus (cattle) microRNA bta-mir-323 precursor
    8. Canis lupus dingo (dingo) microRNA 323a (ENSCAFG00020010867.1)
    9. Canis lupus familiaris (dog) miRNA (ENSCAFG00000020533.1, ENSCAFG00030003098.1, ENSCAFG00040007708.1)
    10. Carlito syrichta miRNA (ENSTSYG00000020491.2)
    11. Cercocebus atys (Sooty mangabey) miRNA (ENSCATG00000043073.1)
    12. Chinchilla lanigera (Long-tailed chinchilla) microRNA 323a (ENSCLAG00000021267.1)
    13. Colobus angolensis palliatus microRNA 323a (ENSCANG00000019082.1)
    14. Delphinapterus leucas (beluga whale) microRNA 323a (ENSDLEG00000001983.1)
    15. Equus asinus asinus (donkey) miRNA (ENSEASG00005000064.1)
    16. Equus caballus microRNA eca-mir-323 precursor
    17. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000002706.1)
    18. Gorilla gorilla gorilla microRNA 323a (ENSGGOG00000032589.2)
    19. Heterocephalus glaber microRNA 323a (ENSHGLG00000022776.1, ENSHGLG00100024074.1)
    20. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 323a (ENSSTOG00000016642.2)
    21. Macaca fascicularis (Crab-eating macaque) miRNA
    22. Macaca mulatta microRNA mml-mir-323a precursor
    23. Macaca nemestrina miRNA (ENSMNEG00000010265.1)
    24. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000022150.1)
    25. Marmota marmota marmota (Alpine marmot) microRNA 323a (ENSMMMG00000003232.1)
    26. Monodon monoceros (narwhal) miRNA (ENSMMNG00015012458.1)
    27. Moschus moschiferus microRNA 323a (ENSMMSG00000011937.1)
    28. Nomascus leucogenys miRNA (ENSNLEG00000022081.2)
    29. Otolemur garnettii miRNA (ENSOGAG00000017433.1)
    30. Pan paniscus miRNA (ENSPPAG00000008076.1)
    31. Pan troglodytes (chimpanzee) ptr-mir-323 (ENSPTRG00000027620.2)
    32. Papio anubis miRNA (ENSPANG00000026639.2)
    33. Pongo abelii microRNA 323a (ENSPPYG00000021763.1)
    34. Pongo pygmaeus microRNA ppy-mir-323 precursor
    35. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000023380.1)
    36. Propithecus coquereli miRNA (ENSPCOG00000002521.1)
    37. Rhinolophus ferrumequinum microRNA 323a (ENSRFEG00010004104.1)
    38. Rhinopithecus bieti miRNA (ENSRBIG00000017190.1)
    39. Rhinopithecus roxellana miRNA (ENSRROG00000012764.1)
    40. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005015648.1)
    41. Tupaia belangeri microRNA 323a (ENSTBEG00000017873.1)
    42. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010000740.1)
    43. Ursus americanus miRNA (ENSUAMG00000020963.1)
    44. Ursus maritimus (Polar bear) miRNA (ENSUMAG00000022099.1)
    45. Ursus thibetanus thibetanus microRNA 323a (ENSUTTG00000015026.1)
    46. Vulpes vulpes miRNA (ENSVVUG00000028586.1)
    47. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015005751.1)
    2D structure New