Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-33952101 URS000075AB6F_10090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGUAGGGAUGGAAGCCAUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Alligator mississippiensis (American alligator) ami-miR-135-2-3p
  2. Anolis carolinensis aca-miR-135-2-3p
  3. Columba livia cli-miR-135-2-3p
  4. Gallus gallus gga-miR-135a-2-3p
  5. Homo sapiens hsa-miR-135a-2-3p
  6. Macaca mulatta mml-miR-135a-2-3p
  7. Monodelphis domestica mdo-miR-135a-3p
  8. Xenopus laevis (African clawed frog) Xla-Mir-135-P2d_3p (mature (co-guide))
  9. Xenopus tropicalis Xtr-Mir-135-P2_3p (mature (co-guide))