Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1178-3p URS000075AB23_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1178: Hsa-mir-1178 is a 5′-tailed mirtron that is supported by only four duplex reads, which is insufficient to assess its biogenesis [PMC3431481]. It is one of several miRNAs, including hsa-mir-1276, hsa-mir-197, hsa-mir-217, hsa-mir-485-3p, hsa-mir-502-5p, hsa-mir-526b, hsa-mir-532-3p, hsa-mir-554, hsa-mir-580, hsa-mir583, hsa-miR610, hsa-miR623 and hasa mir942 [PMC6794874]. Expression data is available for three of these miRNAs (hsa mir1178 , hasa miR485 and hasa miR600), all of which show expression in the cerebellum and adrenal gland [PMC5635130]. In silico functional analysis predicts that rs3219151 is included in the target region for four miRNAs: hasa mir1178 (allele = T), hasa mir4855p (allele = T), hasa mir600 (allele = T), and hasa mir920 (allele = C) [PMC5635130]. HsamiR1178 can bind to lncRNA CCAT1 and hsamiR1304 3p [PMC5647044]. HsamiR1178 shows two branch-specific substitutions in human evolution [PMC4966751]. Four mirtrons including hsamiR1178 were downgraded in the MirBase database due to not meeting certain criteria [PMC4556696].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCUCACUGUUCUUCCCUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Pan troglodytes ptr-miR-1178
  2. Pongo pygmaeus (Bornean orangutan) ppy-miR-1178
Publications