Tetraodon nigroviridis (spotted green pufferfish) tni-miR-148 URS000075AB19_99883

• 22 nucleotides
• 2 databases (miRBase, MirGeneDB)
• Found in 8 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UCAGUGCAUUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

1. Cyprinus carpio (common carp) ccr-miR-148
2. Danio rerio dre-miR-148
3. Ictalurus punctatus (channel catfish) ipu-miR-148
4. Mus musculus Mus_musculus piRNA piR-mmu-48797763
5. Salmo salar ssa-miR-148a-3p
6. Takifugu rubripes fru-miR-148
7. Tor tambroides miR-148
8. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1143228

Download

• FASTA
• JSON