Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Danio rerio (zebrafish) dre-miR-148 URS000075AB19_7955

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUUACAGAACUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Cyprinus carpio (common carp) ccr-miR-148
  2. Ictalurus punctatus (channel catfish) ipu-miR-148
  3. Mus musculus Mus_musculus piRNA piR-mmu-48797763
  4. Salmo salar ssa-miR-148a-3p
  5. Takifugu rubripes fru-miR-148
  6. Tetraodon nigroviridis tni-miR-148
  7. Tor tambroides miR-148
  8. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1143228
Publications