Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-619-3p URS000075AB14_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-619: Hsa-mir-619 is a key miRNA that is positively correlated with the presence of STC, while the other six key miRNAs show a negative correlation [PMC7646872]. Hsa-mir-619 is part of the turquoise module, along with hsa-miR-20b, hsa-miR-128, hsa-miR-129-3p, hsa-miR-30b, and hsa-miR-340 [PMC7646872]. In addition to its positive correlation with STC, hsa-mir-619 also shows negative correlations with other miRNAs such as hsa-miR-20b and hsa-miR-486-3p [PMC7646872]. Hsa-mir-619 and hsa-mir9 are both downregulated in both subtypes of STC and target the tumour suppressor gene MDGA2 [PMC5951834]. HSA-MIR495 (CDH2), HSA-MIR382 (FGA), HSA-MIR20A (MMP2, MMP3, CTSK), HSA-MIR449A (P2RY14), HSA-MIR5765P (F9), and HSA-MIR619 (KNG1) are predicted targets of various miRNAs [PMC6391078]. Interestingly, both hsa-mir619 and hsa-mir548a2 are derived from different types of transposable elements (TEs) [PMC7345915]. The hairpin structure of pre-miRNAs, such as hsa-mir-326, hsa-mir-421, and hsa-mir-619, is formed by TEs inserted in proximity to appropriate sequences that are similar to complementary sequences of TE heads or tails [PMC4482582]. The wild-type sequence contains binding sites for both miRNA binding sites for hsa-miR-4254 and hsa-mir-619, while the mutant sequence contains binding sites for hsa-miR-1207-3p and hsa-miR-3135b [PMC6377377].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCUGGACAUGUUUGUGCCCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-619
Publications