Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-6216 precursor URS000075AAE8_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-6216: Rno-mir-6216 is a microRNA that has been studied in the context of stroke. However, there is a lack of published information on its function and targets [PMC5270432]. To gain more insight, the putative targets of rno-mir-6216 were examined. One of its predicted targets is Mapk3, which is involved in the promotion of neuronal precursor cell differentiation [PMC5270432]. Interestingly, rno-mir-6216 has been found to target multiple pathways, including the vascular endothelial growth factor (VEGF) signaling pathway, suggesting its involvement in various functions related to stroke etiology [PMC5270432]. Additionally, rno-mir-6216 has direct targets within the VEGF signaling pathway [PMC5270432]. In a study investigating the effects of electroacupuncture (EA) on stroke recovery, it was found that EA can alter the expression levels of rno-mir-6216 and other miRNAs associated with cell proliferation. This may contribute to improved functional recovery and cerebral blood supply after stroke [PMC6297779] [PMC8846361]. Overall, further research is needed to fully understand the function and targets of rno-mir-6216 in stroke pathology.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGGUGUUUGCUGGAUACACAGAGGCAGGAGGAGAAAGAAGUAUUUCCUCCUGCAUCUGUGUGUAUAGCAGGCACUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications