Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PLS3 antisense RNA 1 (PLS3-AS1) URS000075AAD5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PLS3-AS1: PLS3-AS1 is a positive regulator of BRAF, SIRT1, FLT3, FASLG, TRAF2, ATRX, TERT, SPATA2, and TNFRSF1B and is a risk factor for colorectal cancer (CRC) prognosis [PMC9213787]. It is located on the Xq23 locus and has a similar locus as the target gene HTR2C [PMC9213787] [PMC9454646]. PLS3-AS1 is part of the snoRNA host gene family and encodes proteins with various biological roles [PMC9454646]. It is located approximately 0.25 Mb from DXZ4 and is part of a domain that requires DXZ4 for H3K27me3 maintenance [PMC8267460]. A risk score model for predicting CRC prognosis based on six colorectal cancer-related lncRNAs (CRLs) includes PLS3-AS1 as one of the factors [PMC10033210]. In addition to PLS3-AS1, AC007347.1, ALMS1-IT1, ZNF197-AS1, AC068790.2, WDFY3-AS2, AC116025.2 POLH-AS1 and PCED1B-AS are also risk factors for CRC prognosis [PMC9213787]. These findings suggest that PLS3-AS1 plays a role in CRC prognosis and may be used as a potential biomarker in predicting patient outcomes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGUAUGUGUGGGGCUCCAGCCACUUAGUUGGAAUUCACCAUGAACUGCAUCUCGAGGAUCAAGUUUAGGCUCCCCAGUCCAUUGUGACAUCCAGCAAAGUGGAGCCGGGCGCCCCCAGCAUCCCGUCUGUCUGACGCUAAAUGGCGAGGCUCUCCAACCCACUUAGCUCCAAGCUCAACCUUCUGCAAAAGUUCAACCUUCUGCACCACUGGGGAUAUCGUGCAGCUCAGACAUGGUCUUGCUCUGUUGCCCAGGCUGGAGUGCAGUGGCAUGAUCAUAGCUUACUGCAGCCUCAAAUUCCUGGGCUCAAGUGAUCCUCCCACCUCAGCCUCCAGCAUAGCUGAGACUACAGACACAUGCCACCACACCCAGGUGUCUGCAUCCGGGCUCUUUUUUGUAGUUCUGGUCUAUGUACAAGACAGGAAUAAUAGAGUUGGAGAAGACCCUGAGACGAGCAACUGAAACGGUGAAGGGGACGGAAAGCAAGGCGGGAUAUAAGCUAUAUAUAAAAUGAUAACUCUUCAUAUUAAAACUGGCUAAAGAGAUGGGGUUUCGUCAUGUUGCCCAGGCUGAUGUAGAACUCCUGGCCUCAAGCAAUCCACCUGCUUUGGCCUCCCAAAGUGCUGGGAUUACAGACGUGAGCCACCAUGCCCUGCUGGUUUAACGUUAUAUUGAAGUUUCUCCAACUGAAGGGCAUGUACUGUUGAGCAUGCUCAGAAGCCAAGGUUCAAGCCAUUCUUCAACUAUAGAUGCUUCAACUCAUCUCUCUUUCUUCGGAAUAUUCUCUCCCUUAUCAAUUUCACCAAUUAUACCAAGUAACCCCCUGCUUAUUCCCCUAGAACAGACAGAGCUGAUACUAGUCUGUGCCUUAUGUGAUUUAGAAAAAGACUCUUGGAAUGCAGCCCCAGACCAUGAUGUACAGAGCAUGAGUUGGGUAUUGCCCCAUUUUAUUCUCUAAUUCAGGUGCCCUUGUGCAGUGAAUAACAUGGCAGCUGUGAGACUAGUGAUGCUAAACAGGUUUAAUUUUUGGUGCAAAUUCUAAUGAAUUAAUAAUAGCUGUUUUAAAAAAACACACAGUGCUAAGAAAGACUCUGAGGCUGUUUUCAGGCUCAGUAGAUAAAUUGUACUGUAAGCUGGGAUGAUUUGCCUUGGUUGGGAGAAUGGCACCAGGUGUGACAAGAAUUUGCUAUCUAAGGACUAGAGGCAUCUCACCCGUCCUGAAGAGGUAGGAAGCCUGGGGUAGGCAGAUGUUGAGGUAGAAUGUGGGCCCAGACAAGUUUUAUAAUUUAUAGAACACAACUUUCAAAUGCCCUUGUAAUACAAGGCAACAAUCCUACUUUUCCAGGUCUCUAACAAAAAGCAUCUAGCUGAGCUAGAGUGUUUUCAUGAGGCAUCUGCUACACAAAACAAUGUCUUGCUUAAUAAAUAACACCCGUUUCUACUUGGUGUCAUUUUACUGUUUAAUCAAAACUUAUUUUCACCACUCUUAACCACAAUCUAAAGAAGGAUGCUUCAAUCUCUUCCUGAUUUAGCCUUAAACUUGGUCAUGUGUACCAUUCGACUAGGAUUGCCAGAGUCAGCCACCCUCCCAACAAAGGAUGCUCAGUUAAAUAUUGCACAGAACACACUUAUACUAAAAAUUGUUUGUUGUUUAUCUGAAAUUCAAAUUUAAUGGGGCAUAAUGUAUUUUACUUGGCAAUCCUACCUGUGAUGGACAUAUAUAUUUCCCCCCAGCUUUAUUAAGGUAUAAUUGACAAAUAAAAGUGUAAAUAUUUAUGAUAUAAAUGGAAAUAUAAACAGAUGCUCCUCGACUUUUGAUGGGGUUACAUCCUGAUAAACCUGUCAUAAGUUAAAAAUAUUGUGAGUUGAAAAUUCAUGUAAUACACCUAACUUACUGAAUAUCCUAGCUUGGCCUAGCCAACCUUAAAUGUGCCCAGAACACUUACAUCAGCAUAUUUGGGCUGAUGUAACACAAACCCUAUUUUAUCAUAAACUGUUUAAUAUCUCAUGUAAUUUAUUGAAUACUGUAUUGAAAAUGAAAGAUAAAAUGGUUGUAUGGGUACUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications