Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-568 precursor URS000075AAC2_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-568: Mmu-mir-568 is a microRNA that has been studied in various contexts [PMC9001960]. In a study, it was found that out of six miRNAs, three were increased (mmu-miR-21a-5p, mmu-miR-690, and mmu-miR-7683-3p), while three were downregulated (mmu-miR-207, mmu-miR-455-3p, and mmu-mir-568) [PMC9001960]. Another study showed that antioxidant SFN improved the expression of six miRNAs, including mmu-mir-568 [PMC9001960]. In a larger set of 35 miRNAs, eight were found to be modulated, including mmu-mir-568 [PMC9001960]. The evidence for the processing of long ncRNAs is limited; however, it is possible that some long ncRNAs may serve as precursors for smaller transacting molecules like mmu-mir-568 [PMC2722021]. The precursor of mmu-mir-568 is highly conserved and may be present in other genomes but has not been annotated yet [PMC2632650]. Some pri-miRNAs exhibit conservation along their entire length like mir497~195 and mir99b~let7c~mir125a. Mmu-mir 568 is also one such pri miRNA [PMC2632650].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACACUAUAUUAUGUAUAAAUGUAUACACACUUCUAUAUAUGUCCACAUAUAUGCGGUGUGUGUAUUAUACAGGUAUAGGUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications