v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 221 (LINC00221) URS000075AA0C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00221: LINC00221, a long non-coding RNA (lncRNA), has been identified as a contributor to tumor growth [PMC8035785]. In vivo studies have demonstrated that silencing LINC00221 can suppress tumor growth, suggesting its potential as a therapeutic target [PMC8035785]. Further research has revealed that LINC00221 exerts anti-proliferation and pro-apoptosis effects on acute lymphoblastic leukemia (ALL) cells by down-regulating ATP2A2, a gene involved in calcium homeostasis [PMC7199449]. These findings indicate that LINC00221 may have a tumor-promoting role and could be a target for therapeutic intervention in ALL [PMC7199449]. The down-regulation of ATP2A2 by LINC00221 may disrupt calcium signaling pathways, leading to impaired cell proliferation and increased cell death [PMC7199449]. Understanding the mechanisms by which LINC00221 regulates ATP2A2 expression could provide insights into the pathogenesis of ALL and potentially lead to the development of novel therapeutic strategies [PMC8035785]. Further studies are needed to elucidate the precise mechanisms underlying the effects of LINC00221 on tumor growth and its potential as a therapeutic target for ALL [PMC8035785] [PMC7199449].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUUCCCGACAGCCCCCGCGCAUCUCUGUGGCAGCUGCUCCGUGCUUCCCGCCCCGCCGCGCCCGCCCACCCAACGGCGCUGUGUCCCGCCGGUAGCUCAGCGGGGACUUCCUUUAUGUGGUACAGGGUUGGGCCUGGAGACCCGGAUGCCGGCGAGGUCCUGGCUGGGAGAGGCCGCCGCUGCCUUCAGGUUUCCGAGACAAUGGAGACUCUGAGAACAUCCAGAAAUAUCCACAGGACUGGCGAGGCUGUGGGCUUUCAACCACCACGAGAGGCUGUUUGCAUAUGAUUCUUCUAAAAUUGACAUCAGUGAAAUGCCUUGAAGAUAAUAAAGUGUUGAAGAAAUAAACAAAAUCAGAAUAUAUGGGAUCAGUUAGAAAGCUCUUAUUUAAGUAAUACAAACCAUGUCCUCAGAUGUCACAGAGCUCAGGUAUAGUCAAAAUUGUUUCUUGGAUGAAUCUCUGGAGAAGGAGAGUUGGCUCUGCAGAGAUGGAUCAUCGUGUGUGUCACCCUUGCAAUGUGUUCCUGACAGCCCAUGGAAGCGGGCUAGUGGAUUCAGCUCCAGCAGUAACUGUUGGUUGGGAUGGACAACCCAGAAAUGGGGCAUGUGAGGAAGAGAAAAUGAAAGUGGAUAGCCUGUUACCGAAAACUGCUGGACUAAGACACUUGUAAGCCUGUCAAUCUCAGUGGCCAACAGACAUGAAAAAAAUUUCCAACAUCAUUAAUUAUCAGAGAAAUGCAAAUAAAAACAACAAUGAAAUACCAUCUCAGACCAGUCAUAAUAGCUAAUAUGAAAAAAGUUAAACAAAAAACAGCUGCUGGGUGGGAAGUGAAGAAAAGGGAACACAUACAUGGGUGGUGGAAAUGUAAAUUAGUUCAGCACUGUGCAAAGCAGUUUAGAGAAUUCUCAAAGAACUUGAAACAGAGCUACUGUUUGACCCAGCAAUCCCAUCAUUAGGUAUAUAGCCAAAGUAAAAUAAAUCAUUCUACCAAAAAAUGCACAUGCACUCAUGCCUCUUGCCACACUAUUCACAACAGCAAAGAUAUGGAAUCAAUCUAGGUGCCAAUCAAUGAUGUAUUAGAUGAAUAAAAUGGUAUGUAUGCAAUAUAAAAUCAUAAAAUACCACACAUUCAUAAAAAAAAGUGUGGUGGCUCACACCUAUAAUCCCAGCACUUUGGGAGGCUGAGGCAGACAGAUCAUGAGGUCAGGAGAUCAAGAUCAUCCUGGCCAAUAUAGUGAAACCCCCUCUCUGCUAAAAAUACAAAAUUUAGCUGGGCAUAGUGGCACAUGCCUGUAAUCCCAGCUACCCGGGAGGCUGAGGCAGGAGAAUCACUUGAACCAGGGACUUAGAGGUUGCAGUAAGCUGAGAUCGCGUCACUGCACUCCUGCCUGGUGAGAGAGUGAGACUCUGUCACAAAAGAAACAAAAUCAUGUCCUUUGCAGCAACAUGGAUGCAGCUGGAGGUCAUAGUCGUAAACAAGUUAACACAGAAAAAGGAAACAAAAUAUCACAUGUUCUCACUUGAAAGUGAGUGCUAAAGGUUGAGCACAUGUGGACAUGACCAUGGAAACAAUAGGCACUGUGAACUGCUGGAGUGGGGAGGGAGAGAGAGGUGCAUGGGUUGAAAGACUGACUAUUGGGUAUUAUGCUAACUCCCUGGGUGAGGGGAUCCAUACCCCAAACCUCAGCAUCACACAAUAUGCCCAUGUAAAAAAACUUGCAUAUGUACCCCCUGUACCUGAAAUAAAAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications