Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ST3GAL6 antisense RNA 1 (ST3GAL6-AS1) URS000075A9F4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ST3GAL6-AS1: ST3GAL6-AS1 is a long non-coding RNA (lncRNA) that has been studied to better understand its molecular features and potential associations [PMC7225964]. In a study, patients were divided into quartiles based on their ST3GAL6-AS1 expression levels, and the lowest and highest quartiles were compared. This analysis included 192 patients in each group [PMC7225964]. Recent findings have indicated that the upregulation of ST3GAL6-AS1 promotes adhesion and invasion of multiple melanoma cells [PMC9820221]. Furthermore, a polymorphism has been identified in the ST3GAL6-AS1 gene [PMC6639385]. These findings suggest that ST3GAL6-AS1 may play a role in melanoma progression and invasion [PMC9820221] [PMC6639385]. Further research is needed to fully understand the molecular mechanisms underlying its functions [PMC7225964].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCAGUUGCACGGUGGCCGCCCCCAAAUUCGAGGAGGAAGGUGCAAAGUGGUGGGAGGCUGCGGGUCUCCCGGAGGGUGAGGCGUUGGGGACCAGGCGGGAGCACAGCCGAACCCCUACCUUUCGGGCGGGGCGGACACCAGCCGCGCGCCCUCGCCGGGCGCCGGGACCGGAAAAUCACCGCGAAGGGAGGGACGAGGAAAGGCGGCGGGUGGCUUCAGGACAAGGACUUUGUGAUUACAUUGGGCCCAUCCAGAUCAUCCAGGAUCAUCUUCCCAUCUCAAGAUUCUUCACUUAAUCACAUCUGCAAAAUUCCUUUUGCUGUGUAAGCUGUGAGAUAUCGGUGGGCGAGGAUGUGAUGCCUGAAGAUGUGGCAUCUACCUUGAAACAGUCAAGGACCUGAGGAUGAAGCCAGCAUCUGAGGAAGACAGACAGAAAGGAUCUGGAUACAUCAUGAGCCUGAAAAGUAUCUUGCAUACACAACUGGCAGCACAGAAUCCUGACAAACCUCUCAUCAGAAAUCAACCACAGACUCUUUAUGCUCUUACCAAAAUGCUGGCUUUGAGAACUAAUUAUGAAUGAAAAUUACUGAUGUGAUUUUCAGUCUAGGGAAGAAUAUCAAGUUAAACUUUAUGAAGUCCAAGACAAUGGGAAAAGAAGAGGUGUUCCUGUCCAGGCCCUCUUCCAGUUAGAAGGUGAUGGUUUCCAGAAGUCUGCACCUGUAUUUCAAUUACCUAUAAUGGAGUUUAUAGGACUAAACUAUAUUCACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications