Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4439 precursor URS000075A963_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4439: MIR4439 is a microRNA that has been identified in several studies as having a potential role in cancer initiation and progression. In a study on hepatocellular carcinoma (HCC), four promoter hypomethylations, including MIR4439, were found to be associated with HCC patient survival [PMC5428754]. However, further analysis showed that MIR4439 promoter methylation was not an independent prognostic variable [PMC5428754]. MIR4439 expression was found to be differentially expressed during pregnancy, with a drop in expression during mid-gestation and a gradual increase until birth [PMC8645989]. In addition to its role in cancer and pregnancy, MIR4439 is also highly expressed in various human tissues and cell types [PMC8645989]. Overall, MIR4439 is a microRNA that has been implicated in cancer progression and survival outcomes in HCC patients. It also exhibits differential expression during pregnancy and is highly expressed across different human tissues.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAGUGACUGAUACCUUGGAGGCAUUUUAUCUAAGAUACACACAAAGCAAAUGCCUCUAAGGUAUCAGUUUACCAGGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications