Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neovison vison (American mink) microRNA 124-1 (ENSNVIG00000005843.1) URS000075A939_452646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 90 other species

  1. Ailuropoda melanoleuca microRNA 124-1 (ENSAMEG00000030170.1)
  2. Aotus nancymaae (Ma's night monkey) microRNA 124-1 (ENSANAG00000014020.1)
  3. Balaenoptera musculus (Blue whale) microRNA 124-1 (ENSBMSG00010012221.1)
  4. Bos grunniens (domestic yak) miRNA (ENSBGRG00000002224.1, ENSBGRG00000002230.1)
  5. Bos mutus (wild yak) miRNA (ENSBMUG00000003238.1)
  6. Bos taurus (cattle) microRNA bta-mir-124a precursor (bta-mir-124a-1)
  7. Callithrix jacchus (white-tufted-ear marmoset) cja-mir-124-2 (ENSCJAG00000030494.3)
  8. Camelus dromedarius microRNA 124-1 (ENSCDRG00005020155.1)
  9. Canis lupus dingo microRNA 124-1 (ENSCAFG00020012076.1)
  10. Canis lupus familiaris miRNA (ENSCAFG00000020462.2, ENSCAFG00030025142.1, ENSCAFG00040022770.1, ENSCAFG00845020727.1)
  11. Capra hircus (Goat) miRNA (ENSCHIG00010005974.1)
  12. Castor canadensis miRNA (ENSCCNG00000016566.1)
  13. Catagonus wagneri microRNA 124-1 (ENSCWAG00000018786.1)
  14. Cavia porcellus (domestic guinea pig) microRNA 124-1 (ENSCPOG00000017157.3)
  15. Cebus imitator microRNA 124-1 (ENSCCAG00000002120.1)
  16. Cercocebus atys (Sooty mangabey) microRNA 124-1 (ENSCATG00000000196.1)
  17. Cervus hanglu yarkandensis microRNA 124-1 (ENSCHYG00000015227.1)
  18. Chinchilla lanigera miRNA (ENSCLAG00000020873.1)
  19. Chlorocebus sabaeus (African green monkey) microRNA 124-1 (ENSCSAG00000022038.1)
  20. Colobus angolensis palliatus miRNA (ENSCANG00000037717.1)
  21. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00000021091.1, ENSCGRG00001005985.1, ENSCGRG00015010046.2)
  22. Delphinapterus leucas microRNA 124-1 (ENSDLEG00000000482.1)
  23. Dipodomys ordii (Ord's kangaroo rat) microRNA 124a-1 (ENSDORG00000021073.2)
  24. Echinops telfairi (small Madagascar hedgehog) microRNA 124-1 (ENSETEG00000020671.1)
  25. Equus asinus asinus microRNA 124-1 (ENSEASG00005016377.1)
  26. Equus asinus (ass) microRNA 124-1 (ENSEASG00005016377.2)
  27. Equus caballus (horse) microRNA 124-1 (ENSECAG00000026074.2)
  28. Felis catus (domestic cat) microRNA 124-1 (ENSFCAG00000016440.3)
  29. Fukomys damarensis (Damara mole rat) miRNA (ENSFDAG00000001415.1)
  30. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 124-1 (ENSGGOG00000028677.2)
  31. Heterocephalus glaber microRNA 124-1 (ENSHGLG00000022161.2)
  32. Homo sapiens (human) microRNA hsa-mir-124 precursor (hsa-mir-124-1)
  33. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 124-1 (ENSSTOG00000023130.1)
  34. Lynx canadensis (Canada lynx) microRNA 124-1 (ENSLCNG00005011041.1)
  35. Macaca fascicularis microRNA 124-1 (ENSMFAG00000012645.2)
  36. Macaca mulatta (Rhesus monkey) microRNA mml-mir-124a precursor (mml-mir-124a-2)
  37. Macaca nemestrina (Pig-tailed macaque) microRNA 124-1 (ENSMNEG00000002972.1)
  38. Mandrillus leucophaeus microRNA 124-1 (ENSMLEG00000014055.1)
  39. Marmota marmota marmota (Alpine marmot) microRNA 124-1 (ENSMMMG00000012471.1)
  40. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000022585.1)
  41. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000006923.1)
  42. Microtus ochrogaster microRNA 124a-1 (ENSMOCG00000007009.1)
  43. Monodelphis domestica microRNA mdo-mir-124a precursor (mdo-mir-124a-1)
  44. Monodon monoceros (narwhal) microRNA 124-1 (ENSMMNG00015016191.1)
  45. Moschus moschiferus microRNA 124-1 (ENSMMSG00000002499.1)
  46. Mus caroli microRNA 124a-1 (MGP_CAROLIEiJ_G0007382.1)
  47. Mus musculus microRNA mmu-mir-124 precursor (mmu-mir-124-1)
  48. Mus pahari microRNA 124a-1 (MGP_PahariEiJ_G0007729.1)
  49. Mus spicilegus (steppe mouse) microRNA 124a-1 (ENSMSIG00000014466.1)
  50. Mus spretus microRNA 124a-1 (MGP_SPRETEiJ_G0007740.1)
  51. Mustela putorius furo microRNA 124-1 (ENSMPUG00000022588.1)
  52. Nannospalax galili miRNA (ENSNGAG00000004506.1)
  53. Nomascus leucogenys microRNA 124-1 (ENSNLEG00000023246.2)
  54. Notamacropus eugenii (tammar wallaby) microRNA 124-1 (ENSMEUG00000016940.1)
  55. Ochotona princeps (American pika) miRNA (ENSOPRG00000017600.1)
  56. Octodon degus miRNA (ENSODEG00000021775.1, ENSODEG00000021776.1)
  57. Oryctolagus cuniculus microRNA 124-1 (ENSOCUG00000018923.2)
  58. Otolemur garnettii (small-eared galago) microRNA 124-1 (ENSOGAG00000027596.1)
  59. Ovis aries (sheep) miRNA (ENSOARG00000022410.1, ENSOARG00020007027.1)
  60. Pan paniscus microRNA 124-1 (ENSPPAG00000009149.1)
  61. Panthera leo microRNA 124-1 (ENSPLOG00000000302.1)
  62. Panthera pardus microRNA 124-1 (ENSPPRG00000014484.1)
  63. Panthera tigris altaica (Tiger) microRNA 124-1 (ENSPTIG00000001740.1)
  64. Pan troglodytes microRNA 124-1 (ENSPTRG00000046974.1)
  65. Papio anubis (olive baboon) microRNA 124-1 (ENSPANG00000004561.3)
  66. Peromyscus maniculatus bairdii microRNA 124a-1 (ENSPEMG00000005499.2)
  67. Phocoena sinus microRNA 124-1 (ENSPSNG00000014207.1)
  68. Physeter catodon (sperm whale) microRNA 124-1 (ENSPCTG00005002552.1)
  69. Piliocolobus tephrosceles miRNA (ENSPTEG00000033071.1)
  70. Pongo abelii (Sumatran orangutan) microRNA 124-1 (ENSPPYG00000037897.1)
  71. Procavia capensis (cape rock hyrax) microRNA 124-1 (ENSPCAG00000019176.1)
  72. Prolemur simus (greater bamboo lemur) microRNA 124-1 (ENSPSMG00000011577.1)
  73. Propithecus coquereli microRNA 124-1 (ENSPCOG00000009569.1)
  74. Rattus norvegicus (Norway rat) microRNA rno-mir-124 precursor (rno-mir-124-1)
  75. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 124-1 (ENSRFEG00010015465.1)
  76. Rhinopithecus bieti (Black snub-nosed monkey) microRNA 124-1 (ENSRBIG00000009153.1)
  77. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 124-1 (ENSRROG00000003359.1)
  78. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016788.1)
  79. Sarcophilus harrisii miRNA (ENSSHAG00000028983.1)
  80. Sciurus vulgaris microRNA 124-1 (ENSSVLG00005000363.1)
  81. Spermophilus dauricus (Daurian ground squirrel) miRNA (ENSSDAG00000011724.1)
  82. Suricata suricatta (meerkat) microRNA 124-1 (ENSSSUG00005011299.1)
  83. Sus scrofa (pig) microRNA ssc-mir-124a precursor (ssc-mir-124a-2)
  84. Theropithecus gelada (gelada) microRNA 124-1 (ENSTGEG00000015876.1)
  85. Tursiops truncatus microRNA 124-1 (ENSTTRG00000022226.1)
  86. Urocitellus parryii microRNA 124-1 (ENSUPAG00010003385.1)
  87. Ursus americanus microRNA 124-1 (ENSUAMG00000027634.1)
  88. Ursus maritimus (Polar bear) microRNA 124-1 (ENSUMAG00000021825.1)
  89. Ursus thibetanus thibetanus microRNA 124-1 (ENSUTTG00000001124.1)
  90. Vulpes vulpes (red fox) microRNA 124-1 (ENSVVUG00000002525.1)
  91. Zalophus californianus miRNA (ENSZCAG00015000602.1)
Publications