Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-124 precursor (mmu-mir-124-1) URS000075A939_10090

Automated summary: This pre miRNA sequence is 85 nucleotides long and is found in Mus musculus. Annotated by 5 databases (ENA, RefSeq, MGI, Ensembl, miRBase). Matches 1 Rfam family (mir-124, RF00239). Mus musculus (house mouse) microRNA mmu-mir-124 precursor (mmu-mir-124-1) sequence is a product of ENSMUSG00000065597.3, mir-124-1, mir-124-1 precursor, mir-124-1 precurso, Mir124a-1, mmu-mir-124-1 precursor genes. Found in the house mouse reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 89 other species

    1. Ailuropoda melanoleuca microRNA 124-1 (ENSAMEG00000030170.1)
    2. Aotus nancymaae (Ma's night monkey) miRNA (ENSANAG00000014020.1)
    3. Balaenoptera musculus (Blue whale) miRNA MIR124-1 (ENSBMSG00010012221.1)
    4. Bos grunniens miRNA (ENSBGRG00000002224.1, ENSBGRG00000002230.1)
    5. Bos mutus miRNA (ENSBMUG00000003238.1)
    6. Bos taurus microRNA bta-mir-124a precursor (bta-mir-124a-1)
    7. Callithrix jacchus cja-mir-124-2 (ENSCJAG00000030494.3)
    8. Camelus dromedarius microRNA 124-1 (ENSCDRG00005020155.1)
    9. Canis lupus dingo microRNA 124-1 (ENSCAFG00020012076.1)
    10. Canis lupus familiaris miRNA (ENSCAFG00000020462.2, ENSCAFG00030025142.1, ENSCAFG00040022770.1, ENSCAFG00845020727.1)
    11. Capra hircus (goat) miRNA (ENSCHIG00010005974.1)
    12. Castor canadensis (American beaver) miRNA (ENSCCNG00000016566.1)
    13. Catagonus wagneri (Chacoan peccary) microRNA 124-1 (ENSCWAG00000018786.1)
    14. Cavia porcellus microRNA 124-1 (ENSCPOG00000017157.3)
    15. Cercocebus atys miRNA (ENSCATG00000000196.1)
    16. Cervus hanglu yarkandensis (Yarkand deer) miRNA MIR124-1 (ENSCHYG00000015227.1)
    17. Chinchilla lanigera (Long-tailed chinchilla) miRNA (ENSCLAG00000020873.1)
    18. Chlorocebus sabaeus (African green monkey) miRNA MIR124-1 (ENSCSAG00000022038.1)
    19. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000037717.1)
    20. Cricetulus griseus miRNA (ENSCGRG00000021091.1, ENSCGRG00001005985.1, ENSCGRG00015010046.1)
    21. Delphinapterus leucas microRNA 124-1 (ENSDLEG00000000482.1)
    22. Dipodomys ordii (Ord's kangaroo rat) miRNA (ENSDORG00000021073.2)
    23. Echinops telfairi miRNA (ENSETEG00000020671.1)
    24. Equus asinus asinus (donkey) microRNA 124-1 (ENSEASG00005016377.1)
    25. Equus caballus (horse) microRNA 124-1 (ENSECAG00000026074.2)
    26. Felis catus microRNA 124-1 (ENSFCAG00000016440.3)
    27. Fukomys damarensis miRNA (ENSFDAG00000001415.1)
    28. Gorilla gorilla gorilla microRNA 124-1 (ENSGGOG00000028677.2)
    29. Heterocephalus glaber (naked mole-rat) microRNA 124-1 (ENSHGLG00000022161.1, ENSHGLG00100023964.1)
    30. Homo sapiens (human) microRNA hsa-mir-124 precursor (hsa-mir-124-1)
    31. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA 124-1 (ENSSTOG00000023130.1)
    32. Lynx canadensis (Canada lynx) microRNA 124-1 (ENSLCNG00005011041.1)
    33. Macaca fascicularis microRNA 124-1 (ENSMFAG00000012645.2)
    34. Macaca mulatta (Rhesus monkey) microRNA mml-mir-124a precursor (mml-mir-124a-2)
    35. Macaca nemestrina (Pig-tailed macaque) miRNA (ENSMNEG00000002972.1)
    36. Mandrillus leucophaeus (Drill) miRNA (ENSMLEG00000014055.1)
    37. Marmota marmota marmota (Alpine marmot) microRNA 124-1 (ENSMMMG00000012471.1)
    38. Meriones unguiculatus miRNA (ENSMUGG00000022585.1)
    39. Mesocricetus auratus (Golden Hamster) miRNA (ENSMAUG00000006923.1)
    40. Microtus ochrogaster (vole) microRNA 124a-1 (ENSMOCG00000007009.1)
    41. Monodelphis domestica microRNA mdo-mir-124a precursor (mdo-mir-124a-1)
    42. Monodon monoceros microRNA 124-1 (ENSMMNG00015016191.1)
    43. Moschus moschiferus (Siberian musk deer) microRNA 124-1 (ENSMMSG00000002499.1)
    44. Mus caroli (Ryukyu mouse) microRNA 124a-1 (MGP_CAROLIEiJ_G0007382.1)
    45. Mus pahari (Shrew mouse) microRNA 124a-1 (MGP_PahariEiJ_G0007729.1)
    46. Mus spicilegus (steppe mouse) miRNA (ENSMSIG00000014466.1)
    47. Mus spretus (algerian mouse) microRNA 124a-1 (MGP_SPRETEiJ_G0007740.1)
    48. Mustela putorius furo microRNA 124-1 (ENSMPUG00000022588.1)
    49. Nannospalax galili (Upper Galilee mountains blind mole rat) miRNA (ENSNGAG00000004506.1)
    50. Neogale vison microRNA 124-1 (ENSNVIG00000005843.1)
    51. Nomascus leucogenys miRNA (ENSNLEG00000023246.2)
    52. Notamacropus eugenii (tammar wallaby) microRNA 124-1 (ENSMEUG00000016940.1)
    53. Ochotona princeps miRNA (ENSOPRG00000017600.1)
    54. Octodon degus miRNA (ENSODEG00000021775.1, ENSODEG00000021776.1)
    55. Oryctolagus cuniculus (rabbit) microRNA 124-1 (ENSOCUG00000018923.2)
    56. Otolemur garnettii miRNA (ENSOGAG00000027596.1)
    57. Ovis aries miRNA (ENSOARG00000022410.1, ENSOARG00020007027.1)
    58. Pan paniscus (bonobo) miRNA (ENSPPAG00000009149.1)
    59. Panthera leo microRNA 124-1 (ENSPLOG00000000302.1)
    60. Panthera pardus (leopard) microRNA 124-1 (ENSPPRG00000014484.1)
    61. Panthera tigris altaica (Tiger) microRNA 124-1 (ENSPTIG00000001740.1)
    62. Pan troglodytes miRNA (ENSPTRG00000046974.1)
    63. Papio anubis (olive baboon) miRNA (ENSPANG00000004561.3)
    64. Peromyscus maniculatus bairdii microRNA 124a-1 (ENSPEMG00000005499.2)
    65. Phocoena sinus miRNA (ENSPSNG00000014207.1)
    66. Physeter catodon microRNA 124-1 (ENSPCTG00005002552.1)
    67. Piliocolobus tephrosceles miRNA (ENSPTEG00000033071.1)
    68. Pongo abelii (Sumatran orangutan) miRNA (ENSPPYG00000037897.1)
    69. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019176.1)
    70. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000011577.1)
    71. Propithecus coquereli (Coquerel's sifaka) miRNA (ENSPCOG00000009569.1)
    72. Rattus norvegicus microRNA rno-mir-124 precursor (rno-mir-124-1)
    73. Rhinolophus ferrumequinum microRNA 124-1 (ENSRFEG00010015465.1)
    74. Rhinopithecus bieti miRNA (ENSRBIG00000009153.1)
    75. Rhinopithecus roxellana miRNA (ENSRROG00000003359.1)
    76. Saimiri boliviensis boliviensis miRNA (ENSSBOG00000016788.1)
    77. Sarcophilus harrisii microRNA 124-1 (ENSSHAG00000028983.1)
    78. Sciurus vulgaris (Eurasian red squirrel) miRNA (ENSSVLG00005000363.1)
    79. Spermophilus dauricus miRNA (ENSSDAG00000011724.1)
    80. Suricata suricatta (meerkat) microRNA 124-1 (ENSSSUG00005011299.1)
    81. Sus scrofa microRNA ssc-mir-124a precursor (ssc-mir-124a-2)
    82. Theropithecus gelada microRNA 124-1 (ENSTGEG00000015876.1)
    83. Tursiops truncatus (bottlenosed dolphin) microRNA 124-1 (ENSTTRG00000022226.1)
    84. Urocitellus parryii (Arctic ground squirrel) miRNA (ENSUPAG00010003385.1)
    85. Ursus americanus miRNA (ENSUAMG00000027634.1)
    86. Ursus maritimus miRNA (ENSUMAG00000021825.1)
    87. Ursus thibetanus thibetanus microRNA 124-1 (ENSUTTG00000001124.1)
    88. Vulpes vulpes (red fox) microRNA 124-1 (ENSVVUG00000002525.1)
    89. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015000602.1)
    Publications New