v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CFLAR antisense RNA 1 (CFLAR-AS1) URS000075A8C6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CFLAR-AS1: CFLAR-AS1 is a long non-coding RNA (lncRNA) that has been studied in relation to various diseases, including esophageal squamous cell carcinoma (ESCC) [PMC8268190]. In a study, the combination of Linc00152, CFLAR-AS1, and POU3F3 with CEA achieved a high area under the curve (AUC) of 0.955 [PMC8268190]. CFLAR-AS1 is involved in immune-related pathways such as the TNF signaling pathway and the NF-κB signaling pathway [PMC8750853]. Hu and colleagues reported that CFLAR-AS1 is significantly upregulated in ESCC patients compared to healthy controls [PMC7589026]. CFLAR-AS1 is involved in epigenetic regulation, as well as transcriptional and posttranscriptional regulation [PMC6613612]. It has been experimentally validated as a cancer-related gene according to the lncRNADisease 2.0 database [PMC7880362]. In another study by Hu et al., CFLAR-AS1 was found to be significantly upregulated in ESCC patients compared to healthy controls, with an AUC of 0.651 [PMC6142629].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAUGCAUACAGCCCAGUCUAACGUACAGGAUCAAAAAGAGACCUUAUUUCGGCUGGCAAUUACCUUACCCGCUUGUUCAUUAUCUGACUCCUGCACUCCUCCCAAGUGUUCAAUGUUAACCAGAUGGCAAAGUUAACCAGACAGAGGAAAUCCACAUAAUUACUCUAGAUGAAGCCCCCUAACUGCGGAUUAGAAGGAAAAGAGAUGAAGGGUGCUGCACUAAUAAUAACAACCAUUUUCAACCAAGGCAGGAUUCUGGGCCUAGAAUCUUCAGUGACAAAUUACCAGGAGAGGAGGAGGGAAAUGAAGAGCUGGAGGCCUAGGGAGAUGGUGUGAGGAGAGGAGACUGUGCCUUUCCACUUCUUAAUAAUUAAUGUUCUCCUGCUGCUCUGAGUCUGCAUCACCAGUGAUUCAGUUUGAGUCAGACAUCCAACAACAACUGAGCAAAAGAAUCAUCUCAGAUCCAAGCAAUGGUGACGCGCAGAUAGAAGAGACUGAGGCCAACGACCAAAGCAAAGGACAGCAGAACUGACUGACACAGCUCAGAAAAUAUCCAAAGCUCUGUAUGCUCUGGAAAGGAAGACAAGAAAUGCUAAAGACUCUGGAUAUUGCUCUGUUUCUAUAAGGUCCCACCCAUAUACCAUCUCUUCUUUUGGAUUUCCUUUGGCAGGGUUCCCUUGUAUGGAAGUUCUCAGGAGAACAACACUCUCAGAGUCCCACUGUCUCAAAGAAUUCUUAAUGGACAGCUAUACUUGGCCCCAAGGUUUCAACCUCACACUGAAGAAAGUGACAUAAGAAAACACAAGUCCCAGUGCUAUCAGGGGCUAUCUGGAAAAGCUGCUUAAACAGCAAGUGAAAGAAGGCUCUCCCCUACCCCGUUCUAGACUCACCCUGAAGUUAUUUGAAGGAUCCUUGAGACUCUUUUGGAUUGCUGCUUGGAGAACAUUCCUGUAACUUGUCCCUGCUCCUUGAACUAUAAAAGCAGAAGGGAGGUACUGAGUUAAAACUUACAAAUUAUUAUCAAAUAAAUCUUCAAUAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications