v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1637 (LINC01637) URS000075A891_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01637: LINC01637 is a long intergenic non-protein coding RNA (lncRNA) that has been found to be highly expressed in certain subtypes of acute myeloid leukemia (AML) [PMC6072220]. In addition, it has been shown to be upregulated in T24 and J82 bladder cancer cells compared to TSGH-8301 cells [PMC7349410]. LINC01637 has also been found to co-precipitate with IMP1, UCA1, and NEAT1 lncRNAs [PMC5907460]. Furthermore, LINC01637 is one of the lncRNAs that have been selected for verification of their differential expression in tumor progression [PMC5907460]. It has also been identified as one of the top lncRNAs associated with autophagy in uveal melanoma (UM) patients [PMC9876672]. Additionally, LINC01637 has shown a significant positive association with poor survival in UM patients [PMC9876672]. Overall, LINC01637 is a lncRNA that has been found to be highly expressed in certain subtypes of AML and bladder cancer cells. It has also shown co-precipitation with other lncRNAs and differential expression in tumor progression. In UM patients, it is associated with autophagy and poor survival.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUGUACCGCGUGACGUGAGAGCGGAGCCCGGGUCUGCCCGGGCGCGGGCCCGCGGCCACGGCGUUUGGAUCCCAGAUCCCAGCCCCCGCGCUCAGUCCGGGCUUCCUGACCGGCGCUCUCCGCGUCCCUUCUCGCGCGCCCUUACCUGGGGCUGGGGAGGUGGGGACAGAGCCGGGCGCAGUCGGGGGCACAGCCCUGAGGCGGGGCUGAGGGCCAGGCCGCCACGUCCCUGGACCCUGAAAACGGGCUCGGACCCCCGCUGCAGCGUGGACUCCGGUGUGGCCGCGGGGCGUGCAACCCGGACCCUGGCCAGCUCCGUGUCCUCCAGACCUUUACUCAUGUCCCCGCAUCGCCAGGCCGAGCUGCACCUUCGGUCCCCGCCCGCGGCAGCCGAGGAGAGGAGAGCAAGGCCCAGACCGGGGAGGAACCCACACAGCCUCUGUGCUCCAGCCUGCUUGAAAGACAAGGUCUACCUACAACGCAGAGAUGCACACAUUAAGGACAAUGAAACACCCAAGUGUUAGGAACCAGAAUAAUCAGCCCUAAUAGAGGGGAGGCUGAUCAGGGAGGGCCUCCUGGAGGAGGAGGCACAACAUCAGGGUGCACUGUGAUUUCUGGAGACCCAAGGAGUUCUGGUAAAUGACAGGUGAGAAAAAGAAAAUGUAAUAAAAUAUAAUUGAAAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications