Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryzias latipes (Japanese medaka) ola-miR-1388-5p URS000075A81C_8090

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGACUGUCCAACCUGAGAAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Bos taurus Bta-Mir-1388_5p (mature (guide))
  2. Cavia porcellus cpo-miR-1388-5p
  3. Danio rerio dre-miR-1388-5p
  4. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-1388_5p (mature (guide))
  5. Daubentonia madagascariensis (aye-aye) dma-miR-1388
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1388
  7. Maylandia zebra (zebra mbuna) mze-miR-1388
  8. Monopterus albus (swamp eel) Mal-Mir-1388_5p (mature (guide))
  9. Neolamprologus brichardi (lyretail cichlid) nbr-miR-1388
  10. Oreochromis niloticus (Nile tilapia) oni-miR-1388
  11. Otolemur garnettii (small-eared galago) oga-miR-1388
  12. Pundamilia nyererei pny-miR-1388
  13. Tor tambroides miR-1388-5p
Publications