Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Neolamprologus brichardi nbr-miR-1388 URS000075A81C_32507

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Neolamprologus brichardi. Annotated by 1 database (miRBase). Found in the Neolamprologus brichardi reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGACUGUCCAACCUGAGAAUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Bos taurus (cattle) Bta-Mir-1388_5p (mature (guide))
    2. Cavia porcellus cpo-miR-1388-5p
    3. Danio rerio dre-miR-1388-5p
    4. Dasypus novemcinctus Dno-Mir-1388_5p (mature (guide))
    5. Daubentonia madagascariensis (aye-aye) dma-miR-1388
    6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-1388
    7. Maylandia zebra (zebra mbuna) mze-miR-1388
    8. Monopterus albus Mal-Mir-1388_5p (mature (guide))
    9. Oreochromis niloticus oni-miR-1388
    10. Oryzias latipes ola-miR-1388-5p
    11. Otolemur garnettii (small-eared galago) oga-miR-1388
    12. Pundamilia nyererei pny-miR-1388
    13. Tor tambroides (Thai mahseer) miR-1388-5p