Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 376b (ENSPTEG00000002792.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 376b (ENSPTEG00000002792.1) URS000075A7C0_591936

100 nucleotides
1 database (Ensembl)
Found in 6 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CAGUCCUUCUUUGGUAUUUAAAACGUGGAUAUUCCUUCUAUGUUUACGUGAUUCCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUCAAAUGCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Homo sapiens microRNA hsa-mir-376b precursor
Macaca mulatta microRNA mml-mir-376b precursor
Pan troglodytes miRNA
Pongo abelii miRNA

2D structure