Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-8055 precursor URS000075A786_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-8055: Hsa-mir-8055 is one of the top 10 miRNAs with the most evident differences in expression [PMC7595655]. It is involved in regulating apoptosis by targeting BCL2, FAS, TNF, and other mRNAs [PMC7595655]. In HUVECs induced by H2O2, the expression levels of hsa-mir-8055 were downregulated compared to control HUVECs, but were upregulated in HUVECs treated with vitamin C and H2O2 [PMC7595655]. It was also found to be involved in T-cell responses to specific antigens and was previously shown to be a sepsis marker [PMC7354481]. Furthermore, hsa-mir-8055 is suggested to be regulated by hsa_circ_0071542 through the interactions of a circRNA-miRNA-mRNA network [PMC8119943]. Circ_0071542 is a differentially expressed circRNA in children with fulminant myocarditis and it regulates the expression of MAPK through binding hsa-mir-8055 [PMC7354481]. In conclusion, hsa-mir-8055 is a miRNA that plays a role in apoptosis regulation and T-cell responses. Its expression levels can be influenced by oxidative stress and vitamin C treatment. Additionally, it is involved in circRNA-mediated regulation of MAPK expression. These findings highlight the importance of hsa-mir-8055 in various biological processes and its potential as a biomarker for sepsis and myocarditis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUACGGUCACACUGUGCUCACUUUGUCAAAUAAAAGAUGGAGUCGUUUGACGUCUUUUAACACCCUUUGAGCACAUGAGCAGACGGAGUGAUCAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications