Automated summary: This pre miRNA sequence is 73 nucleotides long and is found in Mus musculus. Annotated by 6 databases (ENA, Ensembl, RefSeq, Rfam, miRBase, MGI). Matches 1 Rfam family (mir-483, RF03778). Mus musculus (house mouse) microRNA mmu-mir-483 precursor sequence is a product of mir-483, mir-483 precursor, ENSMUSG00000070140.3, 483 microRNA precursor famil, 483 microRNA precursor family, mmu-mir-483 precursor, Mir483, mir-483 precurso, mir-483 microRNA precursor family genes. Found in the house mouse reference genome.
This sequence is found in {{ locations.length }} genome
Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
---|---|---|---|---|---|---|---|---|
Loading genome locations... | ||||||||
Failed to load data from server | ||||||||
No genome locations known | ||||||||
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GAGGGGGAAGACGGGAGAAGAGAAGGGAGUGGUUUUUGGGUGCCUCACUCCUCCCCUCCCGUCUUGUUCUCUC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.