Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-6079 precursor URS000075A748_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR6079: MIR6079 is a type of microRNA that has been found to play a role in liver cancer cells. It has been suggested that miR24-2 indirectly facilitates the transcription of METTL3 and enhances the expression of MIR6079 by promoting m6A methylation on pri-MIR6079 in liver cancer cells [PMC8554331]. Additionally, METTL3 promotes the malignant process of hepatocellular carcinoma (HCC) through YTHDF2-dependent silencing of SOCS2 [PMC7238608]. However, the Pim1 3′UTR luciferase activity was not significantly altered in the rLV‐miR24‐2 plus MIR6079 inhibitor group compared to the rLV group [PMC7077597]. Informatics analysis suggests that MIR6079 may bind to the seed sequence of JMJD2A 3′‐UTR [PMC7077597]. It has been observed that MIR6079 enhances H3K9me3 by targeting JMJD2A in liver cancer cells [PMC7077597]. Furthermore, mature MIR6079 was significantly increased in the rLV‐miR24‐2 group compared to the rLV group, but this action was abrogated by inhibiting MIR6079 or increasing JMJD2A in miR24-2 overexpressing Hep3B cells [PMC7077597]. The expression of Pim1 was significantly increased in the rLV‐miR24‐2 group compared to the rLV group, but it was not altered in the rLV‐miR24‐2 plus MIR6079 inhibitor group compared to the rLV control group [PMC7077597]. Overall, these findings suggest that miR24-2 enhances expression of MIR6079 via RNA methylation modification and that MIR6079 increases H3K9me3 by targeting JMJD2A in liver cancer cells [PMC7077597].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUAGACCUAGUAUCAGUGGCCAAAGAAACUUUUUUGGAAGCUUGGACCAACUAGCUGGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes miRNA
Publications